Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16533
Trapped Gene
Tgif1 (ENSMUSG00000047407)
Vector Insertion
Chr 17: 71195511 - 71195739
Public Clones not available
Private Clones OST459045 (lexicon) OST456801 (lexicon) OST456789 (lexicon) OST443830 (lexicon)
OST430736 (lexicon) OST379723 (lexicon) OST374227 (lexicon) OST314997 (lexicon)
OST309439 (lexicon) OST289646 (lexicon) OST248923 (lexicon) OST248228 (lexicon)
OST215348 (lexicon) OST214554 (lexicon) OST209713 (lexicon) OST207447 (lexicon)
OST204118 (lexicon) OST200943 (lexicon) OST194298 (lexicon) OST189317 (lexicon)
OST174854 (lexicon) OST137760 (lexicon) OST132283 (lexicon) OST130594 (lexicon)
OST130233 (lexicon) OST116821 (lexicon) OST113225 (lexicon) OST56094 (lexicon)
OST35480 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606362 (Chr17:71195512..71195738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606362 (Chr17:71195512..71195738 -)
Downstram Exon
ENSMUSE00000716636 (Chr17:71195512..71195738 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55 AGAGGCTGCTGATGAGGAAA Chr17:71195634..71195653 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710962 Chr17:71202788..71202886 CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55
upstream ENSMUSE00000718089 Chr17:71200650..71201074 AAGGATGGGGGTGTCTTTTC Chr17:71200894..71200913 60.17 50
upstream ENSMUSE00000692627 Chr17:71200212..71200550 TCCTAGAAACCCCAGCTTCA Chr17:71200254..71200273 59.81 50
upstream ENSMUSE00000606362 Chr17:71195512..71195738 TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55
upstream ENSMUSE00000716636 Chr17:71195512..71195738 TCTGCGAGACTGGCTGTATG Chr17:71195589..71195608 60.16 55

*** Putative Vector Insertion (Chr 17: 71195511 - 71195739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000714388 Chr17:71193554..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000606361 Chr17:71193552..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000717035 Chr17:71193551..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAGTGACTCTGAGGATG Chr17:71195701..71195721 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCAGTGACTCTGAGGATG Chr17:71195701..71195721 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047407