Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16543
Trapped Gene
4921516M08Rik (ENSMUSG00000078941)
Vector Insertion
Chr 13: 101433909 - 101434005
Public Clones CMHD-GT_421E3-3 (cmhd)
Private Clones OST458888 (lexicon) OST427847 (lexicon) OST420225 (lexicon) OST367957 (lexicon)
OST352988 (lexicon) OST329916 (lexicon) OST319524 (lexicon) OST305041 (lexicon)
OST297890 (lexicon) OST271213 (lexicon) OST242584 (lexicon) OST224954 (lexicon)
OST171654 (lexicon) OST126188 (lexicon) OST124302 (lexicon) OST60054 (lexicon)
OST53685 (lexicon) OST51388 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000119559 (Chr13:101433850..101433908 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATACGACGGCTACGATGAGG Chr13:101433857..101433876 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000119559 (Chr13:101433850..101433908 +)
Downstram Exon
ENSMUSE00000291849 (Chr13:101434006..101434151 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATACGACGGCTACGATGAGG Chr13:101433857..101433876 60.12 55 AGTCACAGCCGTGGTAATCC Chr13:101434075..101434094 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720334 Chr13:101421368..101421400 GCTTCCGAATATCCTGCTCA Chr13:101421378..101421397 60.32 50
upstream ENSMUSE00000360289 Chr13:101424146..101424238 GGGGTTGGAAAAACCACACT Chr13:101424154..101424173 61.01 50
upstream ENSMUSE00000119559 Chr13:101433850..101433908 ATACGACGGCTACGATGAGG Chr13:101433857..101433876 60.12 55

*** Putative Vector Insertion (Chr 13: 101433909 - 101434005) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000291849 Chr13:101434006..101434151 AGTCACAGCCGTGGTAATCC Chr13:101434075..101434094 60 55
downstream ENSMUSE00000365918 Chr13:101435782..101435974 TCCTCGAGCTGTTCTGGTTC Chr13:101435919..101435938 60.53 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGAGTATGGCTGTCCCATT Chr13:101433874..101433895 60.34 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAGTATGGCTGTCCCATT Chr13:101433874..101433895 60.34 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078941