Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16545
Trapped Gene
Ube2t (ENSMUSG00000026429)
Vector Insertion
Chr 1: 136867933 - 136868477
Public Clones not available
Private Clones OST458837 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158985 (Chr1:136867827..136867932 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTCCACAGGTCCGATTT Chr1:136867838..136867857 60.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158985 (Chr1:136867827..136867932 +)
Downstram Exon
ENSMUSE00000158981 (Chr1:136868478..136868576 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTCCACAGGTCCGATTT Chr1:136867838..136867857 60.75 50 GCAATGTTGAGGGATGGTCT Chr1:136868509..136868528 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000158987 Chr1:136859193..136859363 GGGAAGGAGTCCCGTTTCTA Chr1:136859257..136859276 60.43 55
upstream ENSMUSE00000158988 Chr1:136864304..136864475 CTCACGCCTGAAGAAGGAAC Chr1:136864378..136864397 59.99 55
upstream ENSMUSE00000158986 Chr1:136865818..136865887 No primer for this exon
upstream ENSMUSE00000158985 Chr1:136867827..136867932 AACCTCCACAGGTCCGATTT Chr1:136867838..136867857 60.75 50

*** Putative Vector Insertion (Chr 1: 136867933 - 136868477) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158981 Chr1:136868478..136868576 GCAATGTTGAGGGATGGTCT Chr1:136868509..136868528 59.93 50
downstream ENSMUSE00000158983 Chr1:136868683..136868766 TGTCTTGCATGAGCCTCTGT Chr1:136868759..136868778 59.58 50
downstream ENSMUSE00000374748 Chr1:136870377..136870737 TCTGAACGTCAGGGGAAAAC Chr1:136870503..136870522 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATTGCCACCAAAGGTGAG Chr1:136867919..136867939 59.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATTGCCACCAAAGGTGAG Chr1:136867919..136867939 59.97 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026429