Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1656
Trapped Gene
Samd4b (ENSMUSG00000037513)
Vector Insertion
Chr 7: 29186927 - 29188638
Public Clones DA0058 (sanger) YTC556 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254416 (Chr7:29188639..29188762 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCACCCCAGGCTATTCTCAT Chr7:29188650..29188669 59.51 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254416 (Chr7:29188639..29188762 -)
Downstram Exon
ENSMUSE00000254413 (Chr7:29186843..29186926 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCACCCCAGGCTATTCTCAT Chr7:29188650..29188669 59.51 50 AAGGCGTGTTCTGTCATGCT Chr7:29186826..29186845 60.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464193 Chr7:29208455..29208857 ATCCTCGCTAGCTGGTTCAA Chr7:29208607..29208626 59.98 50
upstream ENSMUSE00000254387 Chr7:29198891..29199361 TATTGGGAGCAATGCAAACA Chr7:29198894..29198913 60.07 40
upstream ENSMUSE00000254399 Chr7:29192955..29193194 AAGCGCTCCATGTCACTCAT Chr7:29193143..29193162 60.83 50
upstream ENSMUSE00000254467 Chr7:29192488..29192597 GCTTGCACAAGTATGCTGCT Chr7:29192551..29192570 59.25 50
upstream ENSMUSE00000254458 Chr7:29192250..29192336 GACAGAGCGTCCTCAAGTCC Chr7:29192259..29192278 59.99 60
upstream ENSMUSE00000254452 Chr7:29191388..29191706 AGCCAGTTTACACGGGTGAT Chr7:29191396..29191415 59.48 50
upstream ENSMUSE00000254442 Chr7:29190973..29191058 CGACCAGACGAGGAGAACAT Chr7:29191016..29191035 60.26 55
upstream ENSMUSE00000254432 Chr7:29190508..29190626 GACATTCCCTCGAAAAGCTG Chr7:29190542..29190561 59.81 50
upstream ENSMUSE00000254423 Chr7:29188883..29189081 GGTGTCTCTCCTCGACATGC Chr7:29188920..29188939 60.84 60
upstream ENSMUSE00000254416 Chr7:29188639..29188762 TCACCCCAGGCTATTCTCAT Chr7:29188650..29188669 59.51 50

*** Putative Vector Insertion (Chr 7: 29186927 - 29188638) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254413 Chr7:29186843..29186926 AAGGCGTGTTCTGTCATGCT Chr7:29186826..29186845 60.87 50
downstream ENSMUSE00000535275 Chr7:29185319..29186636 GGGTGGGAAAGTTTGACAGA Chr7:29185634..29185653 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTTTAATCGCCTTGCAG Chr7:29188573..29188593 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCACCCCAGGCTATTCTCA Chr7:29188649..29188669 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037513