Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16560
Trapped Gene
Btbd7 (ENSMUSG00000041702)
Vector Insertion
Chr 12: 104078498 - 104079248
Public Clones not available
Private Clones OST458391 (lexicon) OST455640 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610298 (Chr12:104079249..104079401 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCCATACCGTGTCTCAAA Chr12:104079260..104079279 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610298 (Chr12:104079249..104079401 -)
Downstram Exon
ENSMUSE00000356592 (Chr12:104078310..104078497 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCCATACCGTGTCTCAAA Chr12:104079260..104079279 59.72 50 CCTTGGGGAACATGAATGAG Chr12:104078325..104078344 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000397134 Chr12:104116426..104116616 GCCTAAGCCACTGACAGGAG Chr12:104116563..104116582 60.01 60
upstream ENSMUSE00000610298 Chr12:104079249..104079401 CAGCCATACCGTGTCTCAAA Chr12:104079260..104079279 59.72 50

*** Putative Vector Insertion (Chr 12: 104078498 - 104079248) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000356592 Chr12:104078310..104078497 CCTTGGGGAACATGAATGAG Chr12:104078325..104078344 60.31 50
downstream ENSMUSE00000388027 Chr12:104075828..104076907 CACCCAGAGAGGAGTTCTCG Chr12:104076690..104076709 59.98 60
downstream ENSMUSE00000259139 Chr12:104050845..104051053 CTTGAGGACGGCAATTAAGG Chr12:104050973..104050992 59.7 50
downstream ENSMUSE00000259130 Chr12:104049330..104049405 AACTGATGCTCACCCCATTT Chr12:104049331..104049350 59.41 45
downstream ENSMUSE00000259125 Chr12:104046110..104046270 ATGTGTTCAATCCGCACAAA Chr12:104046122..104046141 59.97 40
downstream ENSMUSE00000392697 Chr12:104033383..104033526 ATATGCCAGCGTTCTTCTGC Chr12:104033405..104033424 60.38 50
downstream ENSMUSE00000352325 Chr12:104031956..104032145 GAGGGCTCGACTGGTTACTG Chr12:104031961..104031980 59.87 60
downstream ENSMUSE00000395936 Chr12:104028915..104029093 CGCCTCACCATATCCTTCAT Chr12:104029035..104029054 59.92 50
downstream ENSMUSE00000610297 Chr12:104026145..104026594 AGTCGGGAGGGGCTACTTTA Chr12:104026215..104026234 60.09 55
downstream ENSMUSE00000386806 Chr12:104022866..104024142 TGGATCGCTCTTCGAGAACT Chr12:104023439..104023458 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr12:104079180..104079200 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATTAACGTGACTGGGAAAAC Chr12:104079182..104079204 58.54 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041702