Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16561
Trapped Gene
2810008M24Rik (ENSMUSG00000071180)
Vector Insertion
Chr 13: 108834681 - 108836618
Public Clones IST13052E7 (tigm)
Private Clones OST458360 (lexicon) OST245059 (lexicon) OST185462 (lexicon) OST177211 (lexicon)
OST174169 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610335 (Chr13:108834640..108834680 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCGCTTTCCACTTTCCT Chr13:108834653..108834672 60.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610335 (Chr13:108834640..108834680 +)
Downstram Exon
ENSMUSE00000610334 (Chr13:108836619..108836762 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCGCTTTCCACTTTCCT Chr13:108834653..108834672 60.73 50 ATACGATGTGGAGGGGGTTA Chr13:108836668..108836687 59.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610335 Chr13:108834640..108834680 CTTCCGCTTTCCACTTTCCT Chr13:108834653..108834672 60.73 50

*** Putative Vector Insertion (Chr 13: 108834681 - 108836618) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000610334 Chr13:108836619..108836762 ATACGATGTGGAGGGGGTTA Chr13:108836668..108836687 59.13 50
downstream ENSMUSE00000610333 Chr13:108837634..108839361 TGTGAGCGCCAAGATAACTG Chr13:108837751..108837770 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr13:108834731..108834751 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTCGTGACTGGGAAAAC Chr13:108834727..108834747 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071180