Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16565
Trapped Gene
Opa3 (ENSMUSG00000052214)
Vector Insertion
Chr 7: 19813934 - 19830102
Public Clones D065D06 (ggtc) (ggtc) D065D06 (ggtc)
Private Clones OST458275 (lexicon) OST449382 (lexicon) OST398887 (lexicon) OST394981 (lexicon)
OST69059 (lexicon) OST47143 (lexicon) OST41866 (lexicon) OST41855 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234418 (Chr7:19813753..19813933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTTCTACTTGGGCATCC Chr7:19813821..19813840 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234418 (Chr7:19813753..19813933 +)
Downstram Exon
ENSMUSE00000394751 (Chr7:19830103..19833210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTTCTACTTGGGCATCC Chr7:19813821..19813840 59.7 55 GCTGCCATGTCCACATACAC Chr7:19833056..19833075 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234418 Chr7:19813753..19813933 GCTGTTCTACTTGGGCATCC Chr7:19813821..19813840 59.7 55

*** Putative Vector Insertion (Chr 7: 19813934 - 19830102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394751 Chr7:19830103..19833210 GCTGCCATGTCCACATACAC Chr7:19833056..19833075 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCAGCCCTCTTTATTTCAT Chr7:19822888..19822908 58.28 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAGCCCTCTTTATTTCAT Chr7:19822888..19822908 58.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052214