Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1657
Trapped Gene
Zkscan1 (ENSMUSG00000029729)
Vector Insertion
Chr 5: 138535368 - 138538294
Public Clones DA0053 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000192129 (Chr5:138535220..138535367 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTCAAGCTTTGACCATCA Chr5:138535289..138535308 59.37 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000192129 (Chr5:138535220..138535367 +)
Downstram Exon
ENSMUSE00000192117 (Chr5:138538295..138538386 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTCAAGCTTTGACCATCA Chr5:138535289..138535308 59.37 45 GGGAATCTGCGGTCAATAGT Chr5:138538387..138538406 59.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000372291 Chr5:138526312..138526459 GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55
upstream ENSMUSE00000686037 Chr5:138526348..138526459 GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55
upstream ENSMUSE00000686033 Chr5:138533868..138534660 CCCAGAGCTTACGGAGAGTG Chr5:138534035..138534054 60.01 60
upstream ENSMUSE00000192121 Chr5:138534148..138534660 CCTCGAGAAGCTTTGAATCG Chr5:138534442..138534461 60.09 50
upstream ENSMUSE00000718095 Chr5:138534148..138534660 CCTCGAGAAGCTTTGAATCG Chr5:138534442..138534461 60.09 50
upstream ENSMUSE00000457488 Chr5:138534154..138534660 CCTCGAGAAGCTTTGAATCG Chr5:138534442..138534461 60.09 50
upstream ENSMUSE00000192129 Chr5:138535220..138535367 TCCTCAAGCTTTGACCATCA Chr5:138535289..138535308 59.37 45

*** Putative Vector Insertion (Chr 5: 138535368 - 138538294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192117 Chr5:138538295..138538386 GGGAATCTGCGGTCAATAGT Chr5:138538387..138538406 59.01 50
downstream ENSMUSE00000192116 Chr5:138538681..138538807 TTCTGACATCCCCATTCCTC Chr5:138538745..138538764 59.86 50
downstream ENSMUSE00000487886 Chr5:138541818..138549050 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55
downstream ENSMUSE00000686032 Chr5:138541818..138545719 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55
downstream ENSMUSE00000686035 Chr5:138541818..138545720 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTCACTTGTGGAAAGAAT Chr5:138535379..138535400 60.49 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTCACTTGTGGAAAGAAT Chr5:138535379..138535400 60.49 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029729