Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16634
Trapped Gene
Cox7b (ENSMUSG00000031231)
Vector Insertion
Chr X: 103215043 - 103217084
Public Clones not available
Private Clones OST456587 (lexicon) OST455874 (lexicon) OST366656 (lexicon) OST233401 (lexicon)
OST220171 (lexicon) OST181004 (lexicon) OST31981 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000281608 (ChrX:103214918..103215042 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGCACCTAGTTTCCATGA ChrX:103214962..103214981 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000281608 (ChrX:103214918..103215042 +)
Downstram Exon
ENSMUSE00000207523 (ChrX:103217085..103217296 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGCACCTAGTTTCCATGA ChrX:103214962..103214981 59.55 50 CAGGGGACATGTTCCATTCT ChrX:103217127..103217146 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411958 ChrX:103211089..103211209 AGGGTAGCTGGGGTGAATTT ChrX:103211102..103211121 59.83 50
upstream ENSMUSE00000281608 ChrX:103214918..103215042 AGGGCACCTAGTTTCCATGA ChrX:103214962..103214981 59.55 50

*** Putative Vector Insertion (Chr X: 103215043 - 103217084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207523 ChrX:103217085..103217296 CAGGGGACATGTTCCATTCT ChrX:103217127..103217146 59.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC ChrX:103215094..103215114 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031231