Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16635
Trapped Gene
6330534C20Rik (ENSMUSG00000073207)
Vector Insertion
Chr X: 50144503 - 50151235
Public Clones B41 (vanderbilt) IST14355A11 (tigm) IST14974A10 (tigm) IST14141E7 (tigm)
IST13764F4 (tigm) IST14613D12 (tigm) IST13764F4 (tigm) IST10923D7 (tigm)
IST14974A10 (tigm) IST10967H11 (tigm) IST10230F8 (tigm) IST14739B7 (tigm)
IST10976G3 (tigm) IST14645B11 (tigm) IST10278H11 (tigm) IST14996F3 (tigm)
Private Clones OST456571 (lexicon) OST435014 (lexicon) OST410971 (lexicon) OST281275 (lexicon)
OST252683 (lexicon) OST217610 (lexicon) OST208996 (lexicon) OST189493 (lexicon)
OST167116 (lexicon) OST105474 (lexicon) OST93358 (lexicon) OST53263 (lexicon)
OST20647 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655890 (ChrX:50144377..50144502 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCTCCTGTCGGTAGTGA ChrX:50144431..50144450 61.41 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655890 (ChrX:50144377..50144502 +)
Downstram Exon
ENSMUSE00000655889 (ChrX:50151236..50152645 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCTCCTGTCGGTAGTGA ChrX:50144431..50144450 61.41 60 TCACGGAGGCTTCCTTTCTA ChrX:50151812..50151831 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655890 ChrX:50144377..50144502 CTGCCTCCTGTCGGTAGTGA ChrX:50144431..50144450 61.41 60

*** Putative Vector Insertion (Chr X: 50144503 - 50151235) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655889 ChrX:50151236..50152645 TCACGGAGGCTTCCTTTCTA ChrX:50151812..50151831 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTAATCGCCTTGCAGCAC ChrX:50147551..50147571 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGACCGTGACTGGGAAAA ChrX:50147548..50147568 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073207