Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16649
Trapped Gene
Dppa4 (ENSMUSG00000058550)
Vector Insertion
Chr 16: 48283955 - 48287990
Public Clones (sanger) (sanger) D148B02 (ggtc) (ggtc) (ggtc) IST12926A8 (tigm)
Private Clones OST456351 (lexicon) OST367616 (lexicon) OST338241 (lexicon) OST316472 (lexicon)
OST315823 (lexicon) OST303333 (lexicon) OST251998 (lexicon) OST218608 (lexicon)
OST170342 (lexicon) OST151881 (lexicon) OST151850 (lexicon) OST145335 (lexicon)
OST141468 (lexicon) OST138476 (lexicon) OST64826 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707235 (Chr16:48283931..48283954 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGACTGCTGGAGACAAG Chr16:48283932..48283951 59.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707235 (Chr16:48283931..48283954 +)
Downstram Exon
ENSMUSE00000488822 (Chr16:48287991..48288108 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGACTGCTGGAGACAAG Chr16:48283932..48283951 59.12 55 TTCTTCCTTCGGCTCTTCTG Chr16:48288020..48288039 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000129201 Chr16:48283848..48283954 GTCTTTTGGAAGCTGGGAGA Chr16:48283879..48283898 59.4 50
upstream ENSMUSE00000707235 Chr16:48283931..48283954 TGGAGACTGCTGGAGACAAG Chr16:48283932..48283951 59.12 55

*** Putative Vector Insertion (Chr 16: 48283955 - 48287990) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000488822 Chr16:48287991..48288108 TTCTTCCTTCGGCTCTTCTG Chr16:48288020..48288039 59.69 50
downstream ENSMUSE00000129203 Chr16:48289152..48289318 GGGGGCAGATACTCTGGAAT Chr16:48289251..48289270 60.29 55
downstream ENSMUSE00000618529 Chr16:48289152..48289213 GTCTGTCCTGGCGTCTCAGT Chr16:48289206..48289225 60.47 60
downstream ENSMUSE00000129208 Chr16:48289441..48289491 TTGTTCTGGGAAAGCCCTTG Chr16:48289491..48289510 62.41 50
downstream ENSMUSE00000331497 Chr16:48291127..48291427 TCAGGGACGTTCCTCAACTC Chr16:48291152..48291171 60.24 55
downstream ENSMUSE00000351172 Chr16:48291127..48291428 TCAGGGACGTTCCTCAACTC Chr16:48291152..48291171 60.24 55
downstream ENSMUSE00000336136 Chr16:48293024..48293219 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55
downstream ENSMUSE00000699695 Chr16:48293024..48293093 CCATGAACCACACACCACAT Chr16:48293051..48293070 60.14 50
downstream ENSMUSE00000699694 Chr16:48293095..48293219 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55
downstream ENSMUSE00000618530 Chr16:48293812..48294405 CATGCGGAGGCTACAGGTAT Chr16:48294265..48294284 60.12 55
downstream ENSMUSE00000707234 Chr16:48293812..48293845 TCCTTCGAGGCTCTTAGTCAA Chr16:48293844..48293864 59.21 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGACTGCTGGAGACAAG Chr16:48286933..48286953 59.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGACTGCTGGAGACAAG Chr16:48286933..48286953 59.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058550