Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16676
Trapped Gene
Ccdc124 (ENSMUSG00000007721)
Vector Insertion
Chr 8: 73393974 - 73397357
Public Clones (ggtc) D187F10 (ggtc) (ggtc) D187F10 (ggtc) IST14873G3 (tigm)
Private Clones OST456016 (lexicon) OST434356 (lexicon) OST413720 (lexicon) OST321818 (lexicon)
OST224819 (lexicon) OST113014 (lexicon) OST112988 (lexicon) OST33819 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224065 (Chr8:73397358..73397389 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224065 (Chr8:73397358..73397389 -)
Downstram Exon
ENSMUSE00000224057 (Chr8:73393804..73393973 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224065 Chr8:73397358..73397389 No primer for this exon

*** Putative Vector Insertion (Chr 8: 73393974 - 73397357) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224057 Chr8:73393804..73393973 No primer for this exon
downstream ENSMUSE00000224053 Chr8:73392832..73393006 No primer for this exon
downstream ENSMUSE00000213492 Chr8:73392636..73392750 No primer for this exon
downstream ENSMUSE00000224042 Chr8:73392127..73392544 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTCAAAAGCCTCAGAAGAAAC Chr8:73394341..73394364 59.92 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCAAAAGCCTCAGAAGAAAC Chr8:73394341..73394364 59.92 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTTCAAAAGCCTCAGAAGAAA Chr8:73394342..73394364 59.13 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTTCAAAAGCCTCAGAAGAAA Chr8:73394342..73394364 59.13 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007721