Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1668
Trapped Gene
Akap12 (ENSMUSG00000038587)
Vector Insertion
Chr 10: 6032799 - 6079872
Public Clones CH0853 (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
XR0032 (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
XQ0024 (sanger) (sanger) (sanger) (sanger) XE004 (baygenomics) YTA052 (baygenomics)
RRJ560 (baygenomics) CSH722 (baygenomics) RRI414 (baygenomics) RRU530 (baygenomics)
P144D02 (ggtc) H005H02 (ggtc) E117C03 (ggtc) P142E07 (ggtc) H003E09 (ggtc)
D095C10 (ggtc) P142A02 (ggtc) H002B09 (ggtc) M118A05 (ggtc) P142G07 (ggtc)
H005F05 (ggtc) E058E05 (ggtc) (ggtc) P142E07 (ggtc) H003C08 (ggtc)
D069B11 (ggtc) P144D02 (ggtc) H005H02 (ggtc) E139A06 (ggtc) A032B01 (ggtc)
P142G07 (ggtc) H005F05 (ggtc) D095C10 (ggtc) (ggtc) P142A02 (ggtc)
H002B09 (ggtc) D069B11 (ggtc) CMHD-GT_539A8-3 (cmhd) (cmhd)
CMHD-GT_347F8-3 (cmhd) CMHD-GT_503D4-3 (cmhd) CMHD-GT_263B5-3 (cmhd) CMHD-GT_411F5-3 (cmhd)
CMHD-GT_437F3-3 (cmhd) CMHD-GT_539A8-5S (cmhd) CMHD-GT_340D7-3 (cmhd) CMHD-GT_421E12-3 (cmhd)
CMHD-GT_379A1-3 (cmhd) CMHD-GT_539A8-3S (cmhd) (cmhd) CMHD-GT_500E7-3 (cmhd)
CMHD-GT_329B1-3 (cmhd) CMHD-GT_437G6-3 (cmhd) IST10457E8 (tigm) IST12928D11 (tigm)
IST14999E7 (tigm) IST12922D3 (tigm) IST15059B6 (tigm) IST12583B10 (tigm)
IST12714E9 (tigm) IST12894D1 (tigm) IST14474B5 (tigm) IST11390B2 (tigm)
IST14836B2 (tigm) IST12905D9 (tigm) IST11259D8 (tigm) IST13230C10 (tigm)
IST14924C5 (tigm) IST10377E6 (tigm) IST12786E6 (tigm) IST14947H4 (tigm)
IST11777F1 (tigm) IST14491C6 (tigm) IST10493D7 (tigm) IST12010H11 (tigm)
IST12873D7 (tigm) IST10462H1 (tigm) IST11744E9 (tigm) IST10692H1 (tigm)
IST12577G6 (tigm) IST14608B10 (tigm) IST10310G12 (tigm) IST11283D7 (tigm)
IST14407F12 (tigm) IST11236A6 (tigm) IST14451D2 (tigm) IST12909D2 (tigm)
IST14407F12 (tigm) IST12905D12 (tigm) IST12068A11 (tigm) IST10359C9 (tigm)
IST10087A7 (tigm) IST10692H1 (tigm) IST14827D2 (tigm) IST10647E11 (tigm)
IST12235A4 (tigm) IST12058H2 (tigm) IST14871E5 (tigm) IST11727A12 (tigm)
IST13197A7 (tigm) IST13056G4 (tigm) IST10198G10 (tigm) IST12416E7 (tigm)
IST11859G4 (tigm) IST10361B11 (tigm) IST10377E6 (tigm) IST12366E11 (tigm)
IST12686E5 (tigm) IST12551A7 (tigm) IST12485D11 (tigm) IST10841H8 (tigm)
IST12905D7 (tigm) IST14937D3 (tigm) IST10493D7 (tigm) IST11744E9 (tigm)
IST12340C2 (tigm)
Private Clones OST464623 (lexicon) OST457741 (lexicon) OST451803 (lexicon) OST448860 (lexicon)
OST430848 (lexicon) OST281599 (lexicon) OST233245 (lexicon) OST224704 (lexicon)
OST216198 (lexicon) OST198661 (lexicon) OST196365 (lexicon) OST171464 (lexicon)
OST142746 (lexicon) OST122868 (lexicon) OST97074 (lexicon) OST96945 (lexicon)
OST96909 (lexicon) OST96897 (lexicon) OST96877 (lexicon) OST87273 (lexicon)
OST87246 (lexicon) OST86942 (lexicon) OST86926 (lexicon) OST86922 (lexicon)
OST86910 (lexicon) OST86906 (lexicon) OST86874 (lexicon) OST86862 (lexicon)
OST86535 (lexicon) OST86511 (lexicon) OST83162 (lexicon) OST45091 (lexicon)
OST38323 (lexicon) OST36613 (lexicon) OST30846 (lexicon) OST30791 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000491803 (Chr10:6079873..6080178 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000491803 (Chr10:6079873..6080178 -)
Downstram Exon
ENSMUSE00000490750 (Chr10:6032684..6032798 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60 CCTCTTGGACGTGGACATCT Chr10:6032704..6032723 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000491803 Chr10:6079873..6080178 ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60

*** Putative Vector Insertion (Chr 10: 6032799 - 6079872) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490750 Chr10:6032684..6032798 CCTCTTGGACGTGGACATCT Chr10:6032704..6032723 60.11 55
downstream ENSMUSE00000577414 Chr10:5991352..5993399 TGTGGATTGCTTCAGCTCAC Chr10:5992977..5992996 59.99 50
downstream ENSMUSE00000577421 Chr10:5991159..5991350 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000519058 Chr10:5988602..5993399 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000515563 Chr10:5987073..5988063 TTTGGTCTCAAGGTCCCAAC Chr10:5987969..5987988 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTCTAATCGCCTTGCAG Chr10:6043807..6043827 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCATTACGTGACTGGGAAA Chr10:6055808..6055828 58.97 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGTCAAAAGCATCGGAGA Chr10:6044195..6044215 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGTCAAAAGCATCGGAGA Chr10:6044195..6044215 61.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038587