Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16694
Trapped Gene
Hnrph2 (ENSMUSG00000045427)
Vector Insertion
Chr X: 131135873 - 131137238
Public Clones D047H04 (ggtc) E067E02 (ggtc) D047H04 (ggtc) D049A02 (ggtc) D014F07 (ggtc)
PST21675-NR (escells) IST13065D8 (tigm)
Private Clones OST455805 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444079 (ChrX:131135825..131135872 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGCCGTTTGAGGGAAGAAG ChrX:131135826..131135845 59.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444079 (ChrX:131135825..131135872 +)
Downstram Exon
ENSMUSE00000694757 (ChrX:131137239..131137301 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGCCGTTTGAGGGAAGAAG ChrX:131135826..131135845 59.45 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694763 ChrX:131135718..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000694761 ChrX:131135764..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000487488 ChrX:131135797..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000694758 ChrX:131135810..131135872 CTCGCTATAGCCGTTTGAGG ChrX:131135819..131135838 60 55
upstream ENSMUSE00000444079 ChrX:131135825..131135872 TAGCCGTTTGAGGGAAGAAG ChrX:131135826..131135845 59.45 50

*** Putative Vector Insertion (Chr X: 131135873 - 131137238) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381195 ChrX:131137231..131137301 No primer for this exon
downstream ENSMUSE00000694757 ChrX:131137239..131137301 No primer for this exon
downstream ENSMUSE00000444073 ChrX:131137457..131137501 CTGACAGAAAATCCACTTCAGG ChrX:131137499..131137520 58.84 45.46
downstream ENSMUSE00000694759 ChrX:131137457..131141297 AGGTGATTACGCATGGGAAG ChrX:131137809..131137828 59.96 50
downstream ENSMUSE00000653740 ChrX:131139394..131141593 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694756 ChrX:131139394..131140923 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694760 ChrX:131139394..131141599 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55
downstream ENSMUSE00000694767 ChrX:131139394..131141585 ACCATAACCCCCTCCATAGC ChrX:131140724..131140743 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTCGTTGGAGGTTGGTGT ChrX:131135862..131135882 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTCGTTGGAGGTTGGTGT ChrX:131135862..131135882 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045427