Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16696
Trapped Gene
Bmf (ENSMUSG00000040093)
Vector Insertion
Chr 2: 118358396 - 118370817
Public Clones CMHD-GT_493F8-3 (cmhd)
Private Clones OST455802 (lexicon) OST379760 (lexicon) OST379351 (lexicon) OST358516 (lexicon)
OST276543 (lexicon) OST74487 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294035 (Chr2:118370818..118370981 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTTCCATCGGCTTCATACG Chr2:118370824..118370843 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294035 (Chr2:118370818..118370981 -)
Downstram Exon
ENSMUSE00000562709 (Chr2:118354496..118358395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTTCCATCGGCTTCATACG Chr2:118370824..118370843 60.1 50 GACTGGCTACTTGGCTCCAG Chr2:118357606..118357625 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458932 Chr2:118375276..118375398 CGGGCGTATTTTGGAAACAA Chr2:118375369..118375388 62.92 45
upstream ENSMUSE00000458923 Chr2:118374777..118374906 CTGAGACGCTGTCCTGGAGT Chr2:118374784..118374803 60.61 60
upstream ENSMUSE00000685699 Chr2:118373107..118373116 No primer for this exon
upstream ENSMUSE00000562711 Chr2:118372452..118372748 CAGTCGACTCCAGCTCTTCC Chr2:118372593..118372612 60.13 60
upstream ENSMUSE00000294035 Chr2:118370818..118370981 AGTTCCATCGGCTTCATACG Chr2:118370824..118370843 60.1 50

*** Putative Vector Insertion (Chr 2: 118358396 - 118370817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562709 Chr2:118354496..118358395 GACTGGCTACTTGGCTCCAG Chr2:118357606..118357625 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCCTTCCCTCTCTTGTTC Chr2:118370769..118370789 60.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCCTTCCCTCTCTTGTTC Chr2:118370769..118370789 60.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040093