Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16705
Trapped Gene
Iars (ENSMUSG00000037851)
Vector Insertion
Chr 13: 49782881 - 49783525
Public Clones not available
Private Clones OST455737 (lexicon) OST408577 (lexicon) OST388767 (lexicon) OST326512 (lexicon)
OST250743 (lexicon) OST222801 (lexicon) OST181857 (lexicon) OST144711 (lexicon)
OST59506 (lexicon) OST42380 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274352 (Chr13:49782755..49782880 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGAATGCCTCAAACAGT Chr13:49782845..49782864 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274352 (Chr13:49782755..49782880 +)
Downstram Exon
ENSMUSE00000274347 (Chr13:49783526..49783682 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGAATGCCTCAAACAGT Chr13:49782845..49782864 60.11 50 TGAGGCAGTCCAGTAGCAAA Chr13:49783573..49783592 59.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000571016 Chr13:49777512..49777572 No primer for this exon
upstream ENSMUSE00000274352 Chr13:49782755..49782880 CCAGGAATGCCTCAAACAGT Chr13:49782845..49782864 60.11 50

*** Putative Vector Insertion (Chr 13: 49782881 - 49783525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274347 Chr13:49783526..49783682 TGAGGCAGTCCAGTAGCAAA Chr13:49783573..49783592 59.59 50
downstream ENSMUSE00000274340 Chr13:49783893..49784012 TCGGCACTGCTTGTTGTACT Chr13:49783982..49784001 59.51 50
downstream ENSMUSE00000274333 Chr13:49785817..49785899 CTGATTCCATGAACTGTGGGTA Chr13:49785896..49785917 59.85 45.46
downstream ENSMUSE00000274328 Chr13:49786863..49786980 CGAGGCCTTTGTCATACAGC Chr13:49786900..49786919 60.8 55
downstream ENSMUSE00000274324 Chr13:49788393..49788540 TTGACGCATAGTGCAAGGTT Chr13:49788514..49788533 59.35 45
downstream ENSMUSE00000274318 Chr13:49797213..49797300 TCTGGCTTCCGTTAAGATGAA Chr13:49797255..49797275 59.83 42.86
downstream ENSMUSE00000274310 Chr13:49797857..49797917 CTTTGAGAGAGGCACCAGGA Chr13:49797882..49797901 60.52 55
downstream ENSMUSE00000274305 Chr13:49798536..49798631 AAGGCACCGTTCTCCTTACA Chr13:49798558..49798577 59.73 50
downstream ENSMUSE00000274300 Chr13:49799640..49799762 TTCACATACTGCCCCACAAA Chr13:49799764..49799783 59.96 45
downstream ENSMUSE00000274293 Chr13:49800202..49800293 CCAGCAGAAAGGGTAGCTGT Chr13:49800294..49800313 59.5 55
downstream ENSMUSE00000274285 Chr13:49801156..49801254 TGTAAATGAGGGGCGTGTCT Chr13:49801181..49801200 60.52 50
downstream ENSMUSE00000274280 Chr13:49802048..49802174 TTTCCAAACCGTTTTTCTCG Chr13:49802086..49802105 60.08 40
downstream ENSMUSE00000274274 Chr13:49803775..49803848 TTCCCGACAGTTCTTCAAGC Chr13:49803823..49803842 60.38 50
downstream ENSMUSE00000274263 Chr13:49804948..49805142 CTCGAACCAGCAGTCAAACA Chr13:49805032..49805051 60.03 50
downstream ENSMUSE00000274254 Chr13:49807119..49807205 CAAGATGAGGCCATTCACAA Chr13:49807203..49807222 59.65 45
downstream ENSMUSE00000274245 Chr13:49810183..49810266 TCTTTTTCCGCTTGCTCATT Chr13:49810217..49810236 59.96 40
downstream ENSMUSE00000274234 Chr13:49811054..49811198 GAAGAAGCGGTAAGCGTTGT Chr13:49811174..49811193 59.52 50
downstream ENSMUSE00000409256 Chr13:49813275..49813395 GCCATTTCGGTCTCAAAGAA Chr13:49813396..49813415 60.19 45
downstream ENSMUSE00000407370 Chr13:49814947..49815038 CCTCCTGTTCATTCGGACAT Chr13:49815032..49815051 59.93 50
downstream ENSMUSE00000455011 Chr13:49816450..49816527 TCCAGAGCCATGACACAGTC Chr13:49816490..49816509 59.83 55
downstream ENSMUSE00000455005 Chr13:49817515..49817636 GTCAGAAAGGGCGTGTAAGG Chr13:49817540..49817559 59.73 55
downstream ENSMUSE00000274205 Chr13:49818039..49818141 CAAGCTCGATCACAGACTGC Chr13:49818106..49818125 59.73 55
downstream ENSMUSE00000454996 Chr13:49818362..49818445 GGTGGATGACCACAATTTCC Chr13:49818395..49818414 60.03 50
downstream ENSMUSE00000274186 Chr13:49819987..49820161 TCAGCCCTTAGTCGGATACC Chr13:49820057..49820076 59.15 55
downstream ENSMUSE00000274178 Chr13:49820590..49820702 ACATGAGGCGAATGTCTTCC Chr13:49820646..49820665 60.08 50
downstream ENSMUSE00000274170 Chr13:49821528..49821623 AGCTTCTGGATGCGATTGAT Chr13:49821616..49821635 59.8 45
downstream ENSMUSE00000274159 Chr13:49822496..49822672 ATTTCATCCGTTGGAACCAG Chr13:49822524..49822543 59.79 45
downstream ENSMUSE00000274151 Chr13:49824028..49824133 CACACACGATCCTTTGGTGA Chr13:49824078..49824097 60.57 50
downstream ENSMUSE00000274146 Chr13:49825384..49825509 TCACCTTTCGGATTCTCCAG Chr13:49825420..49825439 60.19 50
downstream ENSMUSE00000274139 Chr13:49826787..49826930 CAGTCACACACAGCGTCCTC Chr13:49826846..49826865 60.53 60
downstream ENSMUSE00000274135 Chr13:49827709..49827861 TTCTGTCCGAGTGGGTTTTC Chr13:49827766..49827785 60.09 50
downstream ENSMUSE00000365150 Chr13:49829028..49829628 GCAGTTGTTGGCAAGACAGA Chr13:49829103..49829122 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTTCTCTTAATCGCCTTG Chr13:49782923..49782943 59.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACACAGCCTTCTCTCGTG Chr13:49782916..49782936 59.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037851