Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16719
Trapped Gene
l7Rn6 (ENSMUSG00000062797)
Vector Insertion
Chr 7: 97068702 - 97072073
Public Clones not available
Private Clones OST455524 (lexicon) OST436076 (lexicon) OST419686 (lexicon) OST411407 (lexicon)
OST355801 (lexicon) OST337414 (lexicon) OST301211 (lexicon) OST232818 (lexicon)
OST224424 (lexicon) OST221322 (lexicon) OST213442 (lexicon) OST206118 (lexicon)
OST180146 (lexicon) OST144115 (lexicon) OST139408 (lexicon) OST128350 (lexicon)
OST113584 (lexicon) OST106853 (lexicon) OST96016 (lexicon) OST92086 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713158 (Chr7:97072074..97072225 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCCGTTGACTCCTTTACG Chr7:97072077..97072096 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713158 (Chr7:97072074..97072225 -)
Downstram Exon
ENSMUSE00000490457 (Chr7:97068583..97068701 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCCGTTGACTCCTTTACG Chr7:97072077..97072096 59.73 55 TGCTGGGATGAACATTTCTG Chr7:97068578..97068597 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489415 Chr7:97089479..97089695 TAGTGGAGGGTCACGTTCCT Chr7:97089619..97089638 59.57 55
upstream ENSMUSE00000672472 Chr7:97089479..97089594 No primer for this exon
upstream ENSMUSE00000713514 Chr7:97089479..97089709 GAGGCGTGCAAGTTAGGAAG Chr7:97089685..97089704 60.01 55
upstream ENSMUSE00000672471 Chr7:97088490..97088553 GGTTCCAAGAAACCATGGAC Chr7:97088524..97088543 59.24 50
upstream ENSMUSE00000477314 Chr7:97084237..97084474 GGCATGGGAGGATCTGTCTA Chr7:97084341..97084360 60.03 55
upstream ENSMUSE00000487322 Chr7:97072074..97072225 CCTCCGTTGACTCCTTTACG Chr7:97072077..97072096 59.73 55
upstream ENSMUSE00000713158 Chr7:97072074..97072225 CCTCCGTTGACTCCTTTACG Chr7:97072077..97072096 59.73 55

*** Putative Vector Insertion (Chr 7: 97068702 - 97072073) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490457 Chr7:97068583..97068701 TGCTGGGATGAACATTTCTG Chr7:97068578..97068597 59.65 45
downstream ENSMUSE00000711507 Chr7:97067434..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45
downstream ENSMUSE00000672470 Chr7:97067430..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45
downstream ENSMUSE00000515882 Chr7:97067199..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr7:97072003..97072023 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGTTGACTCCTTTACGC Chr7:97072074..97072094 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062797