Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16727
Trapped Gene
Fgfr1 (ENSMUSG00000031565)
Vector Insertion
Chr 8: 26642901 - 26665979
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) E089F12 (ggtc) D097E11 (ggtc) 5SE187F03 (ggtc)
(ggtc) E325C08 (ggtc) E050B03 (ggtc) 5SE285B11 (ggtc) (ggtc)
E112H05 (ggtc) D150H09 (ggtc) E052H09 (ggtc) 5SE285G11 (ggtc) (ggtc)
E323C04 (ggtc) D156C03 (ggtc) (ggtc) E089F12 (ggtc) D097E11 (ggtc)
(ggtc) E052E04 (ggtc) 3SE285G11 (ggtc) (ggtc) E112H05 (ggtc)
D156C03 (ggtc) (cmhd) CMHD-GT_524A1-5S (cmhd) CMHD-GT_421G4-3 (cmhd) IST12640D8 (tigm)
IST13063E9 (tigm) IST10102E7 (tigm) IST13016G11 (tigm) IST12174E8 (tigm)
IST11706B2 (tigm) IST11503D8 (tigm) IST12107G7 (tigm) IST10831G12 (tigm)
IST11364B12 (tigm) IST13663G1 (tigm) IST13082B5 (tigm) IST12121C7 (tigm)
IST11564D5 (tigm) IST12562G7 (tigm) IST11503D9 (tigm) IST11574E2 (tigm)
IST12178A2 (tigm) IST12174D1 (tigm) IST11636D3 (tigm) IST12650H5BBF1 (tigm)
IST12174B5 (tigm) IST14444C6 (tigm) IST13002B1 (tigm) IST11824B7 (tigm)
IST11974G9 (tigm) IST14675D8 (tigm) IST14167A6 (tigm) IST14864A9 (tigm)
IST13803B10 (tigm) IST12171C8 (tigm) IST12838D2 (tigm) IST14274F5 (tigm)
IST13544C11 (tigm) IST11469G8 (tigm) IST10752E7 (tigm) IST11850H8 (tigm)
IST14418A12 (tigm) IST12177B1 (tigm) IST10543B12 (tigm) IST12947F9 (tigm)
IST12905G10HMF1 (tigm) IST10080B2 (tigm) IST10880E9 (tigm) IST12442E12 (tigm)
IST12060F11 (tigm) IST13056F12 (tigm) IST12552G10 (tigm) IST14703G9 (tigm)
IST12880G6 (tigm) IST13044E7 (tigm) IST12437B12 (tigm) IST13061D12 (tigm)
IST12558G7 (tigm) IST14929D3 (tigm)
Private Clones OST455440 (lexicon) OST454997 (lexicon) OST444568 (lexicon) OST175078 (lexicon)
OST102212 (lexicon) OST42153 (lexicon) OST33270 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720184 (Chr8:26642753..26642900 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720184 (Chr8:26642753..26642900 +)
Downstram Exon
ENSMUSE00000710493 (Chr8:26665980..26666246 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55 CCAGTTGATGCTCTGCACAT Chr8:26666089..26666108 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684681 Chr8:26629244..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000708961 Chr8:26629264..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000715929 Chr8:26629267..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000712953 Chr8:26629791..26629901 No primer for this exon
upstream ENSMUSE00000368001 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000710039 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000720184 Chr8:26642753..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55

*** Putative Vector Insertion (Chr 8: 26642901 - 26665979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210796 Chr8:26665944..26666246 CCAGTTGATGCTCTGCACAT Chr8:26666089..26666108 59.86 50
downstream ENSMUSE00000710493 Chr8:26665980..26666246 CCAGTTGATGCTCTGCACAT Chr8:26666089..26666108 59.86 50
downstream ENSMUSE00000514872 Chr8:26668203..26668292 CCTACGGTTTGGTTTGGTGT Chr8:26668294..26668313 59.75 50
downstream ENSMUSE00000684676 Chr8:26668203..26668286 GGTTTGGTGTTGTCCGTCTC Chr8:26668284..26668303 60.41 55
downstream ENSMUSE00000210804 Chr8:26668543..26668715 ATTCGGTGGTCAGGCTTAAA Chr8:26668705..26668724 59.57 45
downstream ENSMUSE00000210814 Chr8:26671192..26671315 CCACGATGCAGGTGTAGTTG Chr8:26671270..26671289 60.17 55
downstream ENSMUSE00000523250 Chr8:26672610..26672800 TTCACCTCGATGTGCTTCAG Chr8:26672754..26672773 59.98 50
downstream ENSMUSE00000715252 Chr8:26673846..26673996 ACACACATACTCCCCGCTCT Chr8:26673929..26673948 59.6 55
downstream ENSMUSE00000523249 Chr8:26674812..26674956 ATAGAGTTACCCGCCAAGCA Chr8:26674918..26674937 59.73 50
downstream ENSMUSE00000210792 Chr8:26677183..26677385 TGGAAGTCGCTCTTCTTGGT Chr8:26677330..26677349 59.99 50
downstream ENSMUSE00000711525 Chr8:26677183..26677379 TGGAAGTCGCTCTTCTTGGT Chr8:26677330..26677349 59.99 50
downstream ENSMUSE00000716690 Chr8:26678288..26678293 No primer for this exon
downstream ENSMUSE00000253494 Chr8:26678660..26678805 AACCAGGAGAACCCCAGAGT Chr8:26678710..26678729 59.97 55
downstream ENSMUSE00000210806 Chr8:26680111..26680232 CACGGTTGGGTTTGTCCTTA Chr8:26680205..26680224 60.78 50
downstream ENSMUSE00000210795 Chr8:26680613..26680723 CGAGATCAGATCCGACAGGT Chr8:26680653..26680672 60.22 55
downstream ENSMUSE00000523247 Chr8:26681182..26681372 CCTCCGGGCCTGTAGATACT Chr8:26681252..26681271 60.48 60
downstream ENSMUSE00000253463 Chr8:26682810..26682932 AGCCAAAGTCTGCGATCTTC Chr8:26682888..26682907 59.58 50
downstream ENSMUSE00000523246 Chr8:26683191..26683261 GGTGTGTGTAGATCCGGTCA Chr8:26683254..26683273 59.39 55
downstream ENSMUSE00000210794 Chr8:26683595..26683732 GAGCCACCCAGAGTGAAGAT Chr8:26683645..26683664 59.26 55
downstream ENSMUSE00000523245 Chr8:26684018..26684123 CCACCAACTGCTTGAACGTA Chr8:26684088..26684107 59.76 50
downstream ENSMUSE00000608945 Chr8:26684217..26686186 TTGAGTGGTGTGGGTTTGAA Chr8:26685823..26685842 59.98 45
downstream ENSMUSE00000710211 Chr8:26684217..26685253 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000711336 Chr8:26684217..26685049 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000718819 Chr8:26684217..26684393 GTACTGGTCCAGCGGTATGG Chr8:26684255..26684274 60.4 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCCACTGAGGAGGGTACA Chr8:26657857..26657877 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCCACTGAGGAGGGTACA Chr8:26657857..26657877 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031565