Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16736
Trapped Gene
Banf2 (ENSMUSG00000037307)
Vector Insertion
Chr 2: 143891140 - 143891270
Public Clones not available
Private Clones OST455329 (lexicon) OST118880 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714197 (Chr2:143891141..143891269 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGCCATCAATTTGGTCAC Chr2:143891234..143891253 58.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714197 (Chr2:143891141..143891269 +)
Downstram Exon
ENSMUSE00000251656 (Chr2:143891141..143891269 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGCCATCAATTTGGTCAC Chr2:143891234..143891253 58.98 45 CCAAATTGATGGCAAGTTCA Chr2:143891252..143891271 59.52 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423017 Chr2:143858838..143858904 TGCTACTGCCTGACCAAGTG Chr2:143858879..143858898 60.05 55
upstream ENSMUSE00000422992 Chr2:143888033..143888151 TGACAGACAGGACCCTTGAA Chr2:143888040..143888059 59.23 50

*** Putative Vector Insertion (Chr 2: 143891140 - 143891270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251656 Chr2:143891141..143891269 CCAAATTGATGGCAAGTTCA Chr2:143891252..143891271 59.52 40
downstream ENSMUSE00000714197 Chr2:143891141..143891269 CCAAATTGATGGCAAGTTCA Chr2:143891252..143891271 59.52 40
downstream ENSMUSE00000348966 Chr2:143899503..143899713 AGCAGCAGATGATCCACCTC Chr2:143899581..143899600 60.38 55
downstream ENSMUSE00000682463 Chr2:143899503..143899715 AGCAGCAGATGATCCACCTC Chr2:143899581..143899600 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCCACCCATGTCTGTTG Chr2:143891119..143891139 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCCACCCATGTCTGTTG Chr2:143891119..143891139 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037307