Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1674
Trapped Gene
Mki67ip (ENSMUSG00000026377)
Vector Insertion
Chr 1: 120220303 - 120224201
Public Clones AF0092 (sanger) CH0035 (sanger) AG0036 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158536 (Chr1:120220159..120220302 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTTTGGCGACATTAGCAG Chr1:120220258..120220277 59.49 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158536 (Chr1:120220159..120220302 +)
Downstram Exon
ENSMUSE00000235698 (Chr1:120224202..120224310 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTTTGGCGACATTAGCAG Chr1:120220258..120220277 59.49 50 TGGCAACATCCTCAGACTCA Chr1:120224259..120224278 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376924 Chr1:120218449..120218574 GACTTGTTCGGGTTCTCCAG Chr1:120218449..120218468 59.7 55
upstream ENSMUSE00000158536 Chr1:120220159..120220302 CAGTTTGGCGACATTAGCAG Chr1:120220258..120220277 59.49 50

*** Putative Vector Insertion (Chr 1: 120220303 - 120224201) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235698 Chr1:120224202..120224310 TGGCAACATCCTCAGACTCA Chr1:120224259..120224278 60.4 50
downstream ENSMUSE00000158539 Chr1:120225930..120226141 AGAGCATTCCTCTGGCTGAA Chr1:120225990..120226009 60.1 50
downstream ENSMUSE00000158537 Chr1:120227183..120227239 TGAGCGACAGCAATGTTCTT Chr1:120227220..120227239 59.6 45
downstream ENSMUSE00000158535 Chr1:120228921..120229055 GGCTGTCCACAGACGACTTC Chr1:120229056..120229075 60.87 60
downstream ENSMUSE00000360516 Chr1:120229327..120230166 CGTCGGTGTACAAACTGGTG Chr1:120229356..120229375 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCGACATTAGCAGATTC Chr1:120220263..120220283 58.87 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCGACATTAGCAGATTCA Chr1:120220264..120220284 60.37 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026377