Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16742
Trapped Gene
Pde4a (ENSMUSG00000032177)
Vector Insertion
Chr 9: 20988996 - 20995770
Public Clones IST13326B6 (tigm)
Private Clones OST455216 (lexicon) OST444591 (lexicon) OST279880 (lexicon) OST260188 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702954 (Chr9:20988781..20988995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCGAGGAGGACACTCTT Chr9:20988950..20988969 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702954 (Chr9:20988781..20988995 +)
Downstram Exon
ENSMUSE00000295102 (Chr9:20995771..20995962 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCGAGGAGGACACTCTT Chr9:20988950..20988969 60.13 55 TCGCTGTCTGAGCGATAGAG Chr9:20995911..20995930 59.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497346 Chr9:20970158..20970676 No primer for this exon
upstream ENSMUSE00000442078 Chr9:20986068..20986264 CTTCCGAGGCAGTGTACAGG Chr9:20986220..20986239 60.84 60
upstream ENSMUSE00000702954 Chr9:20988781..20988995 TCAGCGAGGAGGACACTCTT Chr9:20988950..20988969 60.13 55

*** Putative Vector Insertion (Chr 9: 20988996 - 20995770) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295102 Chr9:20995771..20995962 TCGCTGTCTGAGCGATAGAG Chr9:20995911..20995930 59.44 55
downstream ENSMUSE00000295087 Chr9:20996839..20996875 CAATGAGGTCTTCACCATGC Chr9:20996861..20996880 59.09 50
downstream ENSMUSE00000584948 Chr9:20996964..20997034 GATGGGCACATTGGTTAGGA Chr9:20997026..20997045 60.72 50
downstream ENSMUSE00000584947 Chr9:20999019..20999068 GACAGTGTGGCCTTGCAGAC Chr9:20999069..20999088 61.92 60
downstream ENSMUSE00000584946 Chr9:20999190..20999302 ACAGAGCGGTAGGTCTGCAT Chr9:20999283..20999302 59.9 55
downstream ENSMUSE00000519745 Chr9:21001557..21001622 GCAGGTCTCGCAGAAGAAGT Chr9:21001592..21001611 59.75 55
downstream ENSMUSE00000584945 Chr9:21003037..21003130 TCATTTCCGACAGGTGTGTG Chr9:21003085..21003104 60.57 50
downstream ENSMUSE00000584944 Chr9:21005665..21005861 CCGGTGTGTACCAGCTTTTT Chr9:21005800..21005819 60.03 50
downstream ENSMUSE00000584943 Chr9:21007642..21007740 GCGTACTCCGACACACAAAA Chr9:21007700..21007719 59.76 50
downstream ENSMUSE00000584942 Chr9:21007832..21007996 GTCAGCGTGGTAGTGGTCCT Chr9:21007921..21007940 60.18 60
downstream ENSMUSE00000584941 Chr9:21008768..21008867 GCAGCAAGAATCTCCAGGTC Chr9:21008802..21008821 59.96 55
downstream ENSMUSE00000584940 Chr9:21009414..21009568 CATGTCGATGACCATCTTGC Chr9:21009571..21009590 60.08 50
downstream ENSMUSE00000584939 Chr9:21009735..21009857 TGTCCAGCAAGAGAACTCCA Chr9:21009840..21009859 59.54 50
downstream ENSMUSE00000584938 Chr9:21010589..21010771 TGATGCGATCAGTCCATTGT Chr9:21010676..21010695 60.08 45
downstream ENSMUSE00000584937 Chr9:21015138..21016043 AGCAGAGATGACGGCAGAAT Chr9:21015755..21015774 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCGAGGAGGACACTCTT Chr9:20991951..20991971 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGCGAGGAGGACACTCTT Chr9:20991951..20991971 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032177