Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16761
Trapped Gene
Rhoa (ENSMUSG00000007815)
Vector Insertion
Chr 9: 108230073 - 108233201
Public Clones (ggtc) CMHD-GT_504B3-3 (cmhd)
Private Clones OST454792 (lexicon) OST394890 (lexicon) OST230239 (lexicon) OST192411 (lexicon)
OST168143 (lexicon) OST167203 (lexicon) OST109364 (lexicon) OST66525 (lexicon)
OST54940 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000244545 (Chr9:108229915..108230072 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000244545 (Chr9:108229915..108230072 +)
Downstram Exon
ENSMUSE00000529791 (Chr9:108233202..108233322 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000244596 Chr9:108208754..108208884 No primer for this exon
upstream ENSMUSE00000244569 Chr9:108217639..108217713 No primer for this exon
upstream ENSMUSE00000244545 Chr9:108229915..108230072 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108230073 - 108233201) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000529791 Chr9:108233202..108233322 No primer for this exon
downstream ENSMUSE00000529790 Chr9:108237382..108237512 No primer for this exon
downstream ENSMUSE00000221577 Chr9:108238979..108239742 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr9:108233121..108233141 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAACGTGACTGGGAAAACC Chr9:108233120..108233140 58.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007815