Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16767
Trapped Gene
Elf1 (ENSMUSG00000036461)
Vector Insertion
Chr 14: 79915578 - 79935929
Public Clones IST15068H10 (tigm)
Private Clones OST454698 (lexicon) OST422132 (lexicon) OST405118 (lexicon) OST373397 (lexicon)
OST371394 (lexicon) OST353751 (lexicon) OST337479 (lexicon) OST323286 (lexicon)
OST299414 (lexicon) OST279731 (lexicon) OST276972 (lexicon) OST268926 (lexicon)
OST219362 (lexicon) OST218846 (lexicon) OST212698 (lexicon) OST197064 (lexicon)
OST176834 (lexicon) OST170770 (lexicon) OST165399 (lexicon) OST142540 (lexicon)
OST131945 (lexicon) OST131657 (lexicon) OST115460 (lexicon) OST82245 (lexicon)
OST65040 (lexicon) OST57367 (lexicon) OST56871 (lexicon) OST54198 (lexicon)
OST50042 (lexicon) OST45694 (lexicon) OST43758 (lexicon) OST32753 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000647192 (Chr14:79915481..79915577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGAGGACGAAACCTGAAG Chr14:79915544..79915563 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000647192 (Chr14:79915481..79915577 +)
Downstram Exon
ENSMUSE00000360302 (Chr14:79935930..79936229 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGAGGACGAAACCTGAAG Chr14:79915544..79915563 59.84 55 AAAAGGCCTAAGCAGCTTCC Chr14:79936130..79936149 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512972 Chr14:79881001..79881444 CTTCGGCTCAGAACTTTCCA Chr14:79881274..79881293 60.51 50
upstream ENSMUSE00000647192 Chr14:79915481..79915577 CCAGAGGACGAAACCTGAAG Chr14:79915544..79915563 59.84 55

*** Putative Vector Insertion (Chr 14: 79915578 - 79935929) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360302 Chr14:79935930..79936229 AAAAGGCCTAAGCAGCTTCC Chr14:79936130..79936149 59.99 50
downstream ENSMUSE00000295543 Chr14:79960554..79960734 TTCAGCAACATCCAATGAGC Chr14:79960694..79960713 59.81 45
downstream ENSMUSE00000295536 Chr14:79965269..79965379 GCAGCCTCAATGGTCTCAAT Chr14:79965323..79965342 60.23 50
downstream ENSMUSE00000554267 Chr14:79966957..79967121 TCTTTCTCTTGCGCTGCTCT Chr14:79967121..79967140 60.56 50
downstream ENSMUSE00000554263 Chr14:79969028..79969111 GTGTAGTCGTCGGGGAATCT Chr14:79969075..79969094 59.02 55
downstream ENSMUSE00000612853 Chr14:79970530..79970722 TCTCCCCATGGTCTCGTAGT Chr14:79970717..79970736 59.53 55
downstream ENSMUSE00000295500 Chr14:79972979..79973425 AGAATTCCCGGGCTTTAGAA Chr14:79973225..79973244 60.03 45
downstream ENSMUSE00000474019 Chr14:79979992..79982282 ACTTGGGTTCGCCTCCTTAT Chr14:79980736..79980755 59.96 50
downstream ENSMUSE00000647193 Chr14:79979992..79982283 ACTTGGGTTCGCCTCCTTAT Chr14:79980736..79980755 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:79924628..79924648 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAACATTCCTCAATTCGTG Chr14:79915613..79915633 59.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036461