Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16782
Trapped Gene
Mthfd2 (ENSMUSG00000005667)
Vector Insertion
Chr 6: 83261357 - 83261805
Public Clones not available
Private Clones OST454136 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000194476 (Chr6:83261806..83261928 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000194476 (Chr6:83261806..83261928 -)
Downstram Exon
ENSMUSE00000194486 (Chr6:83261204..83261356 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000238976 Chr6:83267423..83267581 No primer for this exon
upstream ENSMUSE00000194488 Chr6:83263356..83263540 No primer for this exon
upstream ENSMUSE00000194476 Chr6:83261806..83261928 No primer for this exon

*** Putative Vector Insertion (Chr 6: 83261357 - 83261805) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000194486 Chr6:83261204..83261356 No primer for this exon
downstream ENSMUSE00000194484 Chr6:83260406..83260513 No primer for this exon
downstream ENSMUSE00000194478 Chr6:83259456..83259548 No primer for this exon
downstream ENSMUSE00000469203 Chr6:83258927..83259052 No primer for this exon
downstream ENSMUSE00000411249 Chr6:83255700..83256803 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTAGATGGCCTCCTTGTTC Chr6:83261819..83261839 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTAGATGGCCTCCTTGTTC Chr6:83261819..83261839 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005667