Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16783
Trapped Gene
Pecam1 (ENSMUSG00000020717)
Vector Insertion
Chr 11: 106515531 - 106516477
Public Clones CMHD-GT_512B3-3 (cmhd) CMHD-GT_402A4-3 (cmhd) CMHD-GT_446B6-3 (cmhd) CMHD-GT_387A5-3 (cmhd)
CMHD-GT_502G8-3 (cmhd) CMHD-GT_390F3-3 (cmhd) CMHD-GT_535C5-3 (cmhd) CMHD-GT_498D6-3 (cmhd)
CMHD-GT_380G1-3 (cmhd)
Private Clones OST454106 (lexicon) OST432716 (lexicon) OST430441 (lexicon) OST423167 (lexicon)
OST413083 (lexicon) OST405789 (lexicon) OST395422 (lexicon) OST381918 (lexicon)
OST379260 (lexicon) OST367943 (lexicon) OST357957 (lexicon) OST351449 (lexicon)
OST311007 (lexicon) OST251994 (lexicon) OST223587 (lexicon) OST204642 (lexicon)
OST158030 (lexicon) OST152469 (lexicon) OST113920 (lexicon) OST51776 (lexicon)
OST37525 (lexicon) OST16303 (lexicon) OST6899 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661174 (Chr11:106515532..106516476 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661174 (Chr11:106515532..106516476 -)
Downstram Exon
ENSMUSE00000585656 (Chr11:106515532..106516476 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000452699 Chr11:106611457..106611942 No primer for this exon
upstream ENSMUSE00000347116 Chr11:106576333..106576498 No primer for this exon
upstream ENSMUSE00000576240 Chr11:106576333..106576595 No primer for this exon
upstream ENSMUSE00000325497 Chr11:106576216..106576242 No primer for this exon
upstream ENSMUSE00000325487 Chr11:106560906..106561199 No primer for this exon
upstream ENSMUSE00000325479 Chr11:106558366..106558668 No primer for this exon
upstream ENSMUSE00000325470 Chr11:106557068..106557343 No primer for this exon
upstream ENSMUSE00000108522 Chr11:106552250..106552498 No primer for this exon
upstream ENSMUSE00000108545 Chr11:106550090..106550365 No primer for this exon
upstream ENSMUSE00000325450 Chr11:106546275..106546562 No primer for this exon
upstream ENSMUSE00000108539 Chr11:106545542..106545649 No primer for this exon
upstream ENSMUSE00000108547 Chr11:106544907..106544934 No primer for this exon
upstream ENSMUSE00000108521 Chr11:106544194..106544267 No primer for this exon
upstream ENSMUSE00000108535 Chr11:106542346..106542399 No primer for this exon
upstream ENSMUSE00000108537 Chr11:106540863..106540925 No primer for this exon
upstream ENSMUSE00000389077 Chr11:106533056..106533112 No primer for this exon
upstream ENSMUSE00000671175 Chr11:106532734..106532750 No primer for this exon
upstream ENSMUSE00000671178 Chr11:106523316..106523338 No primer for this exon
upstream ENSMUSE00000342087 Chr11:106523111..106523338 No primer for this exon
upstream ENSMUSE00000585656 Chr11:106515532..106516476 No primer for this exon
upstream ENSMUSE00000661174 Chr11:106515532..106516476 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAACGGAAGGCTCCCTTAAT Chr11:106516454..106516475 60.44 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGGAAGGCTCCCTTAAT Chr11:106516454..106516475 60.44 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020717