Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16792
Trapped Gene
Zfp787 (ENSMUSG00000046792)
Vector Insertion
Chr 7: 6094753 - 6107446
Public Clones (sanger) P115G06 (ggtc) D088G04 (ggtc) P115G06 (ggtc) CMHD-GT_298C11-3 (cmhd)
IST14662G7 (tigm) IST12643B6 (tigm) IST14372H6 (tigm) IST14634E10 (tigm)
IST14389C5 (tigm) IST10914E9 (tigm) IST14490A8 (tigm) IST14336E9 (tigm)
Private Clones OST453999 (lexicon) OST439505 (lexicon) OST295561 (lexicon) OST283208 (lexicon)
OST202730 (lexicon) OST65064 (lexicon) OST30149 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000600778 (Chr7:6107447..6107540 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAGGCGAGAGGAAGAGT Chr7:6107475..6107494 62.88 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000600778 (Chr7:6107447..6107540 -)
Downstram Exon
ENSMUSE00000493318 (Chr7:6094664..6094752 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAGGCGAGAGGAAGAGT Chr7:6107475..6107494 62.88 60 TCTGCTGGTCCTCAGAATCC Chr7:6094663..6094682 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340868 Chr7:6107447..6107573 CTGACCCCAGGGTCTGAGTC Chr7:6107523..6107542 62.08 65
upstream ENSMUSE00000600778 Chr7:6107447..6107540 AGGCAGGCGAGAGGAAGAGT Chr7:6107475..6107494 62.88 60

*** Putative Vector Insertion (Chr 7: 6094753 - 6107446) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493318 Chr7:6094664..6094752 TCTGCTGGTCCTCAGAATCC Chr7:6094663..6094682 60.35 55
downstream ENSMUSE00000368124 Chr7:6084091..6084773 GCAGTCGGGGCAAGTATAAG Chr7:6084366..6084385 59.73 55
downstream ENSMUSE00000426959 Chr7:6083915..6084088 CACTCCATGCACACATACGG Chr7:6083977..6083996 61.02 55
downstream ENSMUSE00000600779 Chr7:6083091..6084773 CCCAACTGCATGGATCTTCT Chr7:6083805..6083824 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGCAGTTGGCTTAGGGTA Chr7:6095449..6095469 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGCAGTTGGCTTAGGGTA Chr7:6095449..6095469 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGCCAACAGAAGCAGATGT Chr7:6095528..6095548 59.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGCCAACAGAAGCAGATGT Chr7:6095528..6095548 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046792