Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI168
Trapped Gene
Ppil1 (ENSMUSG00000024007)
Vector Insertion
Chr 17: 29389264 - 29398681
Public Clones GC0166 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137198 (Chr17:29398682..29398836 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCAAGTTCCACAGGATCA Chr17:29398724..29398743 59.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137198 (Chr17:29398682..29398836 -)
Downstram Exon
ENSMUSE00000236458 (Chr17:29389195..29389263 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCAAGTTCCACAGGATCA Chr17:29398724..29398743 59.52 50 CATAAATAGATGCGCCACCTC Chr17:29389218..29389238 59.58 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000137197 Chr17:29400817..29400883 CCCAACGTCTACCTGGAGACTA Chr17:29400818..29400839 60.54 54.54
upstream ENSMUSE00000137198 Chr17:29398682..29398836 CACCAAGTTCCACAGGATCA Chr17:29398724..29398743 59.52 50

*** Putative Vector Insertion (Chr 17: 29389264 - 29398681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236458 Chr17:29389195..29389263 CATAAATAGATGCGCCACCTC Chr17:29389218..29389238 59.58 47.62
downstream ENSMUSE00000236429 Chr17:29387775..29388670 ACAGCATCCCACCTATCCAG Chr17:29388416..29388435 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGGAACTGGGTGGTAAG Chr17:29398640..29398660 60.74 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATACGTGACTGGGAAAA Chr17:29398616..29398636 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024007