Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1680
Trapped Gene
Fkbp15 (ENSMUSG00000066151)
Vector Insertion
Chr 4: 62007176 - 62013466
Public Clones CG0814 (sanger) CSH734 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000526781 (Chr4:62013467..62013579 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACTATGGGCCATGGAAAT Chr4:62013525..62013544 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000526781 (Chr4:62013467..62013579 -)
Downstram Exon
ENSMUSE00000526780 (Chr4:62007091..62007175 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACTATGGGCCATGGAAAT Chr4:62013525..62013544 59.65 45 GGCTTTGGTGCTGTCTGATT Chr4:62007132..62007151 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526782 Chr4:62021404..62021496 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000632398 Chr4:62021404..62021568 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000673191 Chr4:62021404..62021582 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000526781 Chr4:62013467..62013579 CAACTATGGGCCATGGAAAT Chr4:62013525..62013544 59.65 45

*** Putative Vector Insertion (Chr 4: 62007176 - 62013466) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526780 Chr4:62007091..62007175 GGCTTTGGTGCTGTCTGATT Chr4:62007132..62007151 60.26 50
downstream ENSMUSE00000526779 Chr4:62006542..62006611 TTTGCCCTGCTTTGCATATT Chr4:62006559..62006578 60.59 40
downstream ENSMUSE00000526778 Chr4:62001656..62001730 GCTGCTGCTGACTGATGTAAA Chr4:62001675..62001695 59.24 47.62
downstream ENSMUSE00000526777 Chr4:62001268..62001366 ACAGCGGCCTTCTCTGACTC Chr4:62001262..62001281 62.06 60
downstream ENSMUSE00000526776 Chr4:61999520..61999669 GACACAGCACTGCATCCAAG Chr4:61999596..61999615 60.47 55
downstream ENSMUSE00000526775 Chr4:61998091..61998159 CGAAGCGGCTTATCTTTGTT Chr4:61998100..61998119 59.5 45
downstream ENSMUSE00000526801 Chr4:61997435..61997581 TTGGCTGAGTCCAGCCTATT Chr4:61997451..61997470 59.84 50
downstream ENSMUSE00000526800 Chr4:61995155..61995294 GCCATCAGAGCCAGAATCTC Chr4:61995240..61995259 59.92 55
downstream ENSMUSE00000526799 Chr4:61994717..61994774 No primer for this exon
downstream ENSMUSE00000526798 Chr4:61993225..61993332 CTTGGCCTTGACCGTATCAG Chr4:61993287..61993306 60.65 55
downstream ENSMUSE00000526797 Chr4:61990382..61990484 CTGTGAGGCCATCTGTGGTA Chr4:61990361..61990380 59.7 55
downstream ENSMUSE00000526796 Chr4:61988847..61988953 AGAACCAGATGGCTGAGGTG Chr4:61988912..61988931 60.26 55
downstream ENSMUSE00000526795 Chr4:61987093..61987207 TAGGCTTGCACACCTGCATA Chr4:61987163..61987182 60.42 50
downstream ENSMUSE00000526794 Chr4:61985146..61985255 TGCCATTCGAATTTCAGTGT Chr4:61985166..61985185 59.13 40
downstream ENSMUSE00000526793 Chr4:61984231..61984338 CCATTGTGACCGACATGCTA Chr4:61984250..61984269 60.54 50
downstream ENSMUSE00000526792 Chr4:61983217..61983311 CTCTGGTTGCGTTCAATGAG Chr4:61983195..61983214 59.44 50
downstream ENSMUSE00000673187 Chr4:61982023..61982095 GGCTGTTTGAAGCGAGTTGT Chr4:61982016..61982035 60.44 50
downstream ENSMUSE00000526791 Chr4:61981993..61982095 GGCTGTTTGAAGCGAGTTGT Chr4:61982016..61982035 60.44 50
downstream ENSMUSE00000673185 Chr4:61981676..61982095 TGAGAACCTGGGGTTACAGG Chr4:61981719..61981738 59.96 55
downstream ENSMUSE00000632397 Chr4:61979976..61980032 No primer for this exon
downstream ENSMUSE00000526790 Chr4:61975288..61975459 CTTCTGGTGAGCCGTCATTT Chr4:61975360..61975379 60.26 50
downstream ENSMUSE00000526789 Chr4:61973292..61973428 TCGGAGGTCAGTCAGCTCTT Chr4:61973294..61973313 60.13 55
downstream ENSMUSE00000673190 Chr4:61972306..61973428 AATCAGCTACGCCTGCACTT Chr4:61973218..61973237 60.04 50
downstream ENSMUSE00000526788 Chr4:61968972..61969127 TGTGACTTGCGAATCTCGTC Chr4:61969026..61969045 59.99 50
downstream ENSMUSE00000526787 Chr4:61967929..61968081 CTCAGCCTGTGCAAGAGTCA Chr4:61968039..61968058 60.33 55
downstream ENSMUSE00000526786 Chr4:61966944..61967063 GTCTTCTCCAGTCGCTGCAT Chr4:61966971..61966990 60.56 55
downstream ENSMUSE00000526785 Chr4:61966157..61966264 CTCAGAATGGTCCCTCCATC Chr4:61966157..61966176 59.46 55
downstream ENSMUSE00000526784 Chr4:61965225..61965940 CAGGGGCTTCTTCTCCTCTT Chr4:61965838..61965857 59.95 55
downstream ENSMUSE00000603996 Chr4:61964195..61964291 CCTCGGAACTTTCAGAGTCG Chr4:61964212..61964231 59.98 55
downstream ENSMUSE00000603995 Chr4:61961377..61962024 TCCTCTTCAGCAGGTCAGGT Chr4:61961749..61961768 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr4:62013395..62013415 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCATTAGGGCTGTGTCT Chr4:62013436..62013456 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066151