Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16824
Trapped Gene
Gm561 (ENSMUSG00000074754)
Vector Insertion
Chr 2: 144419942 - 144420783
Public Clones (sanger) CMHD-GT_382A8-3 (cmhd) CMHD-GT_397G3-3 (cmhd)
Private Clones OST453631 (lexicon) OST366948 (lexicon) OST328883 (lexicon) OST328875 (lexicon)
OST328871 (lexicon) OST328847 (lexicon) OST310480 (lexicon) OST305589 (lexicon)
OST286656 (lexicon) OST286637 (lexicon) OST264145 (lexicon) OST255500 (lexicon)
OST215673 (lexicon) OST29521 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640434 (Chr2:144419819..144419941 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAATGTCCCTTGTCTACGC Chr2:144419860..144419879 60.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640434 (Chr2:144419819..144419941 +)
Downstram Exon
ENSMUSE00000640433 (Chr2:144420784..144421101 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAATGTCCCTTGTCTACGC Chr2:144419860..144419879 60.66 55 TTTCATTCCTTGAGCCATCC Chr2:144420825..144420844 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640434 Chr2:144419819..144419941 CGAATGTCCCTTGTCTACGC Chr2:144419860..144419879 60.66 55

*** Putative Vector Insertion (Chr 2: 144419942 - 144420783) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640433 Chr2:144420784..144421101 TTTCATTCCTTGAGCCATCC Chr2:144420825..144420844 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000074754