Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16825
Trapped Gene
Oxsm (ENSMUSG00000021786)
Vector Insertion
Chr 14: 17074304 - 17075313
Public Clones not available
Private Clones OST453625 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000120874 (Chr14:17074305..17075312 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTTATGGACTCTCGGGTGA Chr14:17074353..17074372 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000120874 (Chr14:17074305..17075312 -)
Downstram Exon
ENSMUSE00000722211 (Chr14:17074305..17075312 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTTATGGACTCTCGGGTGA Chr14:17074353..17074372 59.93 55 TCACCCGAGAGTCCATAACC Chr14:17074331..17074350 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456732 Chr14:17081991..17082322 TAAATGTGTCAACCGCCAAA Chr14:17082205..17082224 59.97 40
upstream ENSMUSE00000692464 Chr14:17081553..17081690 GCACAGCCTTCTTTTTACGG Chr14:17081596..17081615 59.88 50
upstream ENSMUSE00000692463 Chr14:17076471..17076617 TGGGCAATCTTCTGGTCACT Chr14:17076542..17076561 60.66 50
upstream ENSMUSE00000692468 Chr14:17075804..17075845 No primer for this exon
upstream ENSMUSE00000120874 Chr14:17074305..17075312 GGTTATGGACTCTCGGGTGA Chr14:17074353..17074372 59.93 55
upstream ENSMUSE00000722211 Chr14:17074305..17075312 GGTTATGGACTCTCGGGTGA Chr14:17074353..17074372 59.93 55

*** Putative Vector Insertion (Chr 14: 17074304 - 17075313) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692462 Chr14:17073148..17073584 GGTGATACGCCTGCATCTTT Chr14:17073524..17073543 60.1 50
downstream ENSMUSE00000692466 Chr14:17072429..17073584 GGTGATACGCCTGCATCTTT Chr14:17073524..17073543 60.1 50
downstream ENSMUSE00000359880 Chr14:17071173..17073584 TACATGGGTCAGGGGTGAAT Chr14:17072696..17072715 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGCTTGTAATCGCCTTGC Chr14:17075250..17075270 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTTGCTGTCTCTTGTGGT Chr14:17075320..17075340 59.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021786