Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16830
Trapped Gene
Rps15 (ENSMUSG00000063457)
Vector Insertion
Chr 10: 79755229 - 79755519
Public Clones not available
Private Clones OST453574 (lexicon) OST26731 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665948 (Chr10:79755204..79755228 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665948 (Chr10:79755204..79755228 +)
Downstram Exon
ENSMUSE00000665947 (Chr10:79755520..79755605 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAGGTGCGCTTCTTCTTCTG Chr10:79755554..79755573 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665948 Chr10:79755204..79755228 No primer for this exon

*** Putative Vector Insertion (Chr 10: 79755229 - 79755519) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000665944 Chr10:79755390..79755605 AAGGTGCGCTTCTTCTTCTG Chr10:79755554..79755573 59.76 50
downstream ENSMUSE00000665947 Chr10:79755520..79755605 AAGGTGCGCTTCTTCTTCTG Chr10:79755554..79755573 59.76 50
downstream ENSMUSE00000574856 Chr10:79756387..79756621 GTTGAAGGTCTTGCCGTTGT Chr10:79756609..79756628 60.16 50
downstream ENSMUSE00000424321 Chr10:79756712..79756857 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665943 Chr10:79756712..79756832 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665946 Chr10:79756712..79756720 No primer for this exon
downstream ENSMUSE00000665945 Chr10:79756784..79756825 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAACCGCCAAGATGGTGAG Chr10:79755215..79755235 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAACCGCCAAGATGGTGAG Chr10:79755215..79755235 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063457