Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16840
Trapped Gene
Trib3 (ENSMUSG00000032715)
Vector Insertion
Chr 2: 152165687 - 152165744
Public Clones not available
Private Clones OST453400 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640019 (Chr2:152165688..152165743 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640019 (Chr2:152165688..152165743 -)
Downstram Exon
ENSMUSE00000281486 (Chr2:152165451..152165743 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCCTCGGACTCTGGGATAC Chr2:152165536..152165555 60.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681777 Chr2:152169593..152169724 CCGAGAGCTGCTCAGTTAGG Chr2:152169646..152169665 60.29 60
upstream ENSMUSE00000640022 Chr2:152168914..152169063 GATGCCAAGTGTCCAGTCCT Chr2:152168969..152168988 60.12 55
upstream ENSMUSE00000595220 Chr2:152168773..152169063 CTTTTGGAACGAGAGCAAGG Chr2:152168828..152168847 59.99 50
upstream ENSMUSE00000640021 Chr2:152168773..152168911 CTTTTGGAACGAGAGCAAGG Chr2:152168828..152168847 59.99 50
upstream ENSMUSE00000640019 Chr2:152165688..152165743 No primer for this exon

*** Putative Vector Insertion (Chr 2: 152165687 - 152165744) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000281486 Chr2:152165451..152165743 AGCCTCGGACTCTGGGATAC Chr2:152165536..152165555 60.62 60
downstream ENSMUSE00000640018 Chr2:152165451..152165686 AGCCTCGGACTCTGGGATAC Chr2:152165536..152165555 60.62 60
downstream ENSMUSE00000595219 Chr2:152163161..152164423 CAAGTCGCTCTGAAGGTTCC Chr2:152164073..152164092 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCTAGGTCCCTTGTGCTT Chr2:152165762..152165782 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTAGGTCCCTTGTGCTT Chr2:152165762..152165782 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032715