Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1686
Trapped Gene
Mysm1 (ENSMUSG00000062627)
Vector Insertion
Chr 4: 94623830 - 94625603
Public Clones CF0781 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000525931 (Chr4:94625604..94625681 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAACTGGTGTGATGCAAA Chr4:94625629..94625648 59.55 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000525931 (Chr4:94625604..94625681 -)
Downstram Exon
ENSMUSE00000525930 (Chr4:94623741..94623829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAACTGGTGTGATGCAAA Chr4:94625629..94625648 59.55 45 TTGCCATCTCCTCCACAGAC Chr4:94623783..94623802 61.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390662 Chr4:94645695..94645791 TGTGGATGTGGAAGGAGATGT Chr4:94645716..94645736 60.38 47.62
upstream ENSMUSE00000349848 Chr4:94641908..94641983 TCAACGTGGAGAAGGGAAAA Chr4:94641918..94641937 60.6 45
upstream ENSMUSE00000358844 Chr4:94639609..94639679 TTGGACTCTGGATAGCACCA Chr4:94639658..94639677 59.24 50
upstream ENSMUSE00000402969 Chr4:94637315..94637392 No primer for this exon
upstream ENSMUSE00000497581 Chr4:94637203..94637226 CCTGCAGAAGTCATCAAAAGC Chr4:94637206..94637226 60.01 47.62
upstream ENSMUSE00000394760 Chr4:94635671..94635749 CAAAACCAGCCAGTCATTCA Chr4:94635716..94635735 59.69 45
upstream ENSMUSE00000298939 Chr4:94634561..94634659 GTGGACCAAAATCGCAACAC Chr4:94634623..94634642 61.35 50
upstream ENSMUSE00000525934 Chr4:94631820..94632562 AGAGGCAGGACTCAAGTGGA Chr4:94632023..94632042 59.99 55
upstream ENSMUSE00000525933 Chr4:94628394..94628524 AGTACGTCCTGGCCTGAAGA Chr4:94628469..94628488 59.87 55
upstream ENSMUSE00000525932 Chr4:94627019..94627122 ACAGGCCACAACCACTTGAT Chr4:94627088..94627107 60.43 50
upstream ENSMUSE00000525931 Chr4:94625604..94625681 GGAAACTGGTGTGATGCAAA Chr4:94625629..94625648 59.55 45

*** Putative Vector Insertion (Chr 4: 94623830 - 94625603) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000525930 Chr4:94623741..94623829 TTGCCATCTCCTCCACAGAC Chr4:94623783..94623802 61.23 55
downstream ENSMUSE00000525929 Chr4:94620563..94620617 No primer for this exon
downstream ENSMUSE00000525928 Chr4:94620189..94620239 No primer for this exon
downstream ENSMUSE00000471179 Chr4:94619554..94619628 TCACCTCTGCCATAGACACG Chr4:94619579..94619598 59.85 55
downstream ENSMUSE00000506734 Chr4:94618865..94619053 TTCTGAGGCCTGTGTCTGTG Chr4:94618948..94618967 60.02 55
downstream ENSMUSE00000520119 Chr4:94617617..94617749 CCAAGCAGGTTATCTGGGAAT Chr4:94617631..94617651 60.33 47.62
downstream ENSMUSE00000508790 Chr4:94615020..94615125 TTCCCACTGAGGTTCTTCTAACA Chr4:94615051..94615073 60.15 43.48
downstream ENSMUSE00000509687 Chr4:94614793..94614850 CGGCGAAAGATTCTATCCAT Chr4:94614799..94614818 59.14 45
downstream ENSMUSE00000510826 Chr4:94608732..94613814 GACAGCTTAGGCTGGAATGC Chr4:94610326..94610345 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCCATATTTGTGGTTCA Chr4:94625577..94625597 59.79 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCCATATTTGTGGTTCA Chr4:94625577..94625597 59.79 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062627