Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16861
Trapped Gene
Mterfd3 (ENSMUSG00000049038)
Vector Insertion
Chr 10: 84583560 - 84589112
Public Clones not available
Private Clones OST453159 (lexicon) OST245876 (lexicon) OST112683 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421866 (Chr10:84589113..84589231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGACAAAATCGCTCAGGA Chr10:84589124..84589143 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421866 (Chr10:84589113..84589231 -)
Downstram Exon
ENSMUSE00000493210 (Chr10:84582181..84583559 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGACAAAATCGCTCAGGA Chr10:84589124..84589143 59.81 45 GCGTCAATTCCAGAACCATT Chr10:84582503..84582522 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422351 Chr10:84590707..84590746 AAGGTCTCTCCGCTGTGCTT Chr10:84590723..84590742 61.49 55
upstream ENSMUSE00000421866 Chr10:84589113..84589231 AAGGACAAAATCGCTCAGGA Chr10:84589124..84589143 59.81 45

*** Putative Vector Insertion (Chr 10: 84583560 - 84589112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493210 Chr10:84582181..84583559 GCGTCAATTCCAGAACCATT Chr10:84582503..84582522 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTTCCCACGTGCAGGTTT Chr10:84586065..84586085 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGTTCCCACGTGCAGGTTT Chr10:84586065..84586085 60.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049038