Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16872
Trapped Gene
Ufc1 (ENSMUSG00000062963)
Vector Insertion
Chr 1: 173220348 - 173224764
Public Clones (sanger) (ggtc) (ggtc) PST17984-NR (escells) PST23350-NR (escells)
IST12298D11 (tigm) IST11189G7 (tigm) IST12298D11 (tigm) IST11450A9 (tigm)
IST14464H9 (tigm) IST14336B10 (tigm) IST12238G7 (tigm) IST14663F9 (tigm)
IST11384G9 (tigm) IST12059C10 (tigm) IST14464H9 (tigm) IST15076A7 (tigm)
Private Clones OST452977 (lexicon) OST348098 (lexicon) OST339639 (lexicon) OST280381 (lexicon)
OST263218 (lexicon) OST183158 (lexicon) OST178045 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687392 (Chr1:173224765..173224911 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCAGCGACTAAAGGAGGA Chr1:173224784..173224803 60.54 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687392 (Chr1:173224765..173224911 -)
Downstram Exon
ENSMUSE00000471460 (Chr1:173220280..173220347 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCAGCGACTAAAGGAGGA Chr1:173224784..173224803 60.54 55 CTCCAGTCGGAACCAATCAT Chr1:173220278..173220297 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474117 Chr1:173225052..173225155 GGCTCCGGTGATTTAATGAT Chr1:173225103..173225122 58.86 45
upstream ENSMUSE00000472330 Chr1:173224765..173224958 GACGCCGTGAGTAAGTGACA Chr1:173224929..173224948 59.9 55
upstream ENSMUSE00000687392 Chr1:173224765..173224911 GTGCAGCGACTAAAGGAGGA Chr1:173224784..173224803 60.54 55

*** Putative Vector Insertion (Chr 1: 173220348 - 173224764) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471460 Chr1:173220280..173220347 CTCCAGTCGGAACCAATCAT Chr1:173220278..173220297 59.93 50
downstream ENSMUSE00000482934 Chr1:173220015..173220078 ACCAGCATTTTCCAAACCAC Chr1:173220037..173220056 59.84 45
downstream ENSMUSE00000510324 Chr1:173219649..173219725 TCCGGAGCAGTAGTGGGATA Chr1:173219672..173219691 60.62 55
downstream ENSMUSE00000506703 Chr1:173219302..173219392 GGGCCATGAGATGAGCTAGT Chr1:173219285..173219304 59.27 55
downstream ENSMUSE00000687391 Chr1:173218696..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45
downstream ENSMUSE00000518418 Chr1:173218694..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGGTCAGTTTTACTCCTG Chr1:173224747..173224767 59.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCAGCGACTAAAGGAGGA Chr1:173221782..173221802 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGAGAATGTCTGTGGTACTTTGT Chr1:173224937..173224961 59.96 41.67 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGAGAATGTCTGTGGTACTTTGT Chr1:173224937..173224961 59.96 41.67 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062963