Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16877
Trapped Gene
Taf12 (ENSMUSG00000028899)
Vector Insertion
Chr 4: 131838961 - 131840958
Public Clones not available
Private Clones OST452931 (lexicon) OST231019 (lexicon) OST86727 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000183257 (Chr4:131838709..131838960 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000183257 (Chr4:131838709..131838960 +)
Downstram Exon
ENSMUSE00000381198 (Chr4:131840959..131841036 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50 TTCATCCAGCTGCTCATTAGG Chr4:131841026..131841046 60.36 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414762 Chr4:131830328..131830402 CTGCTGAGACGAAAGCTTCA Chr4:131830338..131830357 59.47 50
upstream ENSMUSE00000668044 Chr4:131830331..131830402 CTGCTGAGACGAAAGCTTCA Chr4:131830338..131830357 59.47 50
upstream ENSMUSE00000668043 Chr4:131837909..131837993 CAGTGGGCTTACAGCAGTTG Chr4:131837939..131837958 59.51 55
upstream ENSMUSE00000183257 Chr4:131838709..131838960 AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50
upstream ENSMUSE00000668042 Chr4:131838709..131838960 AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50

*** Putative Vector Insertion (Chr 4: 131838961 - 131840958) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381198 Chr4:131840959..131841036 TTCATCCAGCTGCTCATTAGG Chr4:131841026..131841046 60.36 47.62
downstream ENSMUSE00000338088 Chr4:131845230..131845344 GCAGCTGGACGTCTTTTACC Chr4:131845341..131845360 59.88 55
downstream ENSMUSE00000373585 Chr4:131847778..131847866 TGAGCCTCTGTGGTACATGC Chr4:131847862..131847881 59.86 55
downstream ENSMUSE00000333148 Chr4:131848542..131849006 TGGTTGTTTTCCGGATCAGT Chr4:131848572..131848591 60.35 45
downstream ENSMUSE00000668041 Chr4:131848542..131848627 TGGTTGTTTTCCGGATCAGT Chr4:131848572..131848591 60.35 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCCCCCTCTCTAATTTGG Chr4:131838986..131839006 60.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCCCCCTCTCTAATTTGG Chr4:131838986..131839006 60.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028899