Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16887
Trapped Gene
Exosc5 (ENSMUSG00000061286)
Vector Insertion
Chr 7: 26449468 - 26450439
Public Clones not available
Private Clones OST452723 (lexicon) OST330308 (lexicon) OST321478 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511402 (Chr7:26449346..26449467 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGTCAGGAATACCTGTGA Chr7:26449371..26449391 60.13 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511402 (Chr7:26449346..26449467 +)
Downstram Exon
ENSMUSE00000513713 (Chr7:26450440..26450580 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGTCAGGAATACCTGTGA Chr7:26449371..26449391 60.13 52.38 GTCCAGCACGAGATTTCCAT Chr7:26450562..26450581 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506623 Chr7:26444221..26444402 CTCACTGACACCGGAACAGA Chr7:26444288..26444307 59.86 55
upstream ENSMUSE00000508430 Chr7:26448156..26448269 CCACCCTTGAAGTGATCCTG Chr7:26448228..26448247 60.5 55
upstream ENSMUSE00000511402 Chr7:26449346..26449467 GCTGGTCAGGAATACCTGTGA Chr7:26449371..26449391 60.13 52.38

*** Putative Vector Insertion (Chr 7: 26449468 - 26450439) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000513713 Chr7:26450440..26450580 GTCCAGCACGAGATTTCCAT Chr7:26450562..26450581 60.08 50
downstream ENSMUSE00000512779 Chr7:26451272..26451361 CGTCAGAATAGAGCCCCTTG Chr7:26451359..26451378 59.83 55
downstream ENSMUSE00000598239 Chr7:26452719..26453041 ATTCCCGGTAGAATCGGAAG Chr7:26452785..26452804 60.28 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGCTGGCTCTGTATCCTT Chr7:26449457..26449477 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGCTGGCTCTGTATCCTT Chr7:26449457..26449477 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061286