Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16893
Trapped Gene
547127 (ENSMUSG00000038141)
Vector Insertion
Chr 17: 6279685 - 6280597
Public Clones not available
Private Clones OST452631 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704127 (Chr17:6279677..6279684 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704127 (Chr17:6279677..6279684 +)
Downstram Exon
ENSMUSE00000658473 (Chr17:6280598..6280701 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACGAAGACGGTCAGTCCAAA Chr17:6280693..6280712 60.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704131 Chr17:6270475..6270590 No primer for this exon
upstream ENSMUSE00000704127 Chr17:6279677..6279684 No primer for this exon

*** Putative Vector Insertion (Chr 17: 6279685 - 6280597) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658473 Chr17:6280598..6280701 ACGAAGACGGTCAGTCCAAA Chr17:6280693..6280712 60.69 50
downstream ENSMUSE00000450300 Chr17:6286926..6286981 GCAGGCAAAGTCTCGATCAC Chr17:6286956..6286975 60.96 55
downstream ENSMUSE00000450297 Chr17:6288986..6289073 ACAACGCACATCAGCCATAG Chr17:6289056..6289075 59.75 50
downstream ENSMUSE00000450294 Chr17:6290557..6290678 GTCCGGTTGTGAACCTTGTT Chr17:6290659..6290678 59.87 50
downstream ENSMUSE00000450288 Chr17:6294924..6295034 CCACGATGATTTCTGCACAT Chr17:6294948..6294967 59.53 45
downstream ENSMUSE00000555293 Chr17:6295722..6295802 AGCACCACAAACACGAAGTG Chr17:6295789..6295808 59.79 50
downstream ENSMUSE00000555296 Chr17:6297228..6297327 GTCCCTCATGGAGAACTTGC Chr17:6297272..6297291 59.66 55
downstream ENSMUSE00000704130 Chr17:6297852..6297982 GGAAGAAGTCGTCCAGCATC Chr17:6297920..6297939 59.81 55
downstream ENSMUSE00000626789 Chr17:6298149..6298240 CAGCAGTCCAACGATGAAGA Chr17:6298208..6298227 59.98 50
downstream ENSMUSE00000658470 Chr17:6299363..6299420 CAACCCGATACTGGTACATGG Chr17:6299405..6299425 60.12 52.38
downstream ENSMUSE00000658469 Chr17:6300892..6300994 GCATGCTCGCACTATCAAGA Chr17:6300969..6300988 60.13 50
downstream ENSMUSE00000658468 Chr17:6301402..6301453 CAAAGGTCAACGCAGTCAAA Chr17:6301440..6301459 59.88 45
downstream ENSMUSE00000704126 Chr17:6303221..6303301 CTTGTGCTCCAAACCGTAGG Chr17:6303258..6303277 60.68 55
downstream ENSMUSE00000704129 Chr17:6303221..6303303 CTTGTGCTCCAAACCGTAGG Chr17:6303258..6303277 60.68 55
downstream ENSMUSE00000704125 Chr17:6304244..6304335 CGTACAGGGCATTCTTCGAC Chr17:6304338..6304357 60.66 55
downstream ENSMUSE00000658465 Chr17:6304246..6304335 CGTACAGGGCATTCTTCGAC Chr17:6304338..6304357 60.66 55
downstream ENSMUSE00000658464 Chr17:6304577..6304643 CACGTCATCGTCAGAGTCGT Chr17:6304638..6304657 59.9 55
downstream ENSMUSE00000658463 Chr17:6305369..6305783 GGCTCAGTCACTGTCCGACT Chr17:6305453..6305472 60.47 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCTTGGTTTGCCTCTCT Chr17:6279647..6279667 60.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAACATGGAACACTGAGGA Chr17:6279673..6279693 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038141