Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1690
Trapped Gene
Sacm1l (ENSMUSG00000025240)
Vector Insertion
Chr 9: 123479684 - 123486094
Public Clones CF0757 (sanger) RRR062 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000149185 (Chr9:123479615..123479683 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAGAGGCATTTTGATTCAC Chr9:123479625..123479645 60.07 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000149185 (Chr9:123479615..123479683 +)
Downstram Exon
ENSMUSE00000149183 (Chr9:123486095..123486174 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAGAGGCATTTTGATTCAC Chr9:123479625..123479645 60.07 42.86 TTTGCGAATGTTTGCTCAAG Chr9:123486144..123486163 59.99 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384105 Chr9:123438900..123439039 No primer for this exon
upstream ENSMUSE00000337292 Chr9:123451462..123451559 CATTGACCGAGTGTCCACAG Chr9:123451525..123451544 60.15 55
upstream ENSMUSE00000360306 Chr9:123456102..123456176 GGATACTGGGCACAATCCAT Chr9:123456147..123456166 59.63 50
upstream ENSMUSE00000397770 Chr9:123457980..123458107 TTTTAATCATGCGGTCTGGA Chr9:123458026..123458045 59.11 40
upstream ENSMUSE00000382177 Chr9:123461786..123461935 TGCAGCGACTATCTAACACGA Chr9:123461880..123461900 59.65 47.62
upstream ENSMUSE00000340690 Chr9:123468343..123468402 GTTTGTATGGAACGGGCATC Chr9:123468354..123468373 60.2 50
upstream ENSMUSE00000378357 Chr9:123469684..123469717 CATCGGTTTGCTCTTCCAGT Chr9:123469687..123469706 60.26 50
upstream ENSMUSE00000149196 Chr9:123475509..123475610 CTCCCGAAGGAGTTGTTTCA Chr9:123475564..123475583 60.22 50
upstream ENSMUSE00000527959 Chr9:123478042..123478127 GCCACGCAGCTAACTTTGTA Chr9:123478057..123478076 59.14 50
upstream ENSMUSE00000356815 Chr9:123479067..123479153 CCACATCCACAGATCAGCAA Chr9:123479121..123479140 60.69 50
upstream ENSMUSE00000149185 Chr9:123479615..123479683 TCCAGAGGCATTTTGATTCAC Chr9:123479625..123479645 60.07 42.86

*** Putative Vector Insertion (Chr 9: 123479684 - 123486094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000149183 Chr9:123486095..123486174 TTTGCGAATGTTTGCTCAAG Chr9:123486144..123486163 59.99 40
downstream ENSMUSE00000149188 Chr9:123488067..123488165 ACTCAATCGATCCCATCTCA Chr9:123488127..123488146 58.01 45
downstream ENSMUSE00000149198 Chr9:123491366..123491504 GAAAACTCCGTCCTGGTTTG Chr9:123491423..123491442 59.57 50
downstream ENSMUSE00000149186 Chr9:123494205..123494274 GTCCCACATGCAAAACTCCT Chr9:123494232..123494251 59.97 50
downstream ENSMUSE00000149193 Chr9:123494403..123494475 TGTTTGGCACAAGCATTAGC Chr9:123494439..123494458 59.88 45
downstream ENSMUSE00000149187 Chr9:123495462..123495555 CCCAACTGAGTTCTTTTTCCA Chr9:123495487..123495507 59.2 42.86
downstream ENSMUSE00000149191 Chr9:123495680..123495772 AGGAATTTCCAGTCCCTTGG Chr9:123495771..123495790 60.3 50
downstream ENSMUSE00000149180 Chr9:123496663..123496720 AAAGGCAACAACCATGATGA Chr9:123496692..123496711 58.98 40
downstream ENSMUSE00000227833 Chr9:123499919..123501716 AAACGCCCAGTAGCTTTTGA Chr9:123501531..123501550 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATTCATAATCGCCTTGC Chr9:123479727..123479747 58.72 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTGGGTAAGAGTGAAGCTGT Chr9:123479673..123479695 58.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025240