Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16909
Trapped Gene
Csad (ENSMUSG00000023044)
Vector Insertion
Chr 15: 102019111 - 102019317
Public Clones not available
Private Clones OST452398 (lexicon) OST404624 (lexicon) OST339644 (lexicon) OST295150 (lexicon)
OST168607 (lexicon) OST165833 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133120 (Chr15:102019318..102019474 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGTCACCAGCTCGTCTGA Chr15:102019347..102019366 60.18 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133120 (Chr15:102019318..102019474 -)
Downstram Exon
ENSMUSE00000133119 (Chr15:102018974..102019110 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGTCACCAGCTCGTCTGA Chr15:102019347..102019366 60.18 55 TTTTGAGTCAGCCATCAGGA Chr15:102019063..102019082 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000133120 Chr15:102019318..102019474 CTTGTCACCAGCTCGTCTGA Chr15:102019347..102019366 60.18 55

*** Putative Vector Insertion (Chr 15: 102019111 - 102019317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133119 Chr15:102018974..102019110 TTTTGAGTCAGCCATCAGGA Chr15:102019063..102019082 59.37 45
downstream ENSMUSE00000285174 Chr15:102018613..102018739 TCTTCAGGCTCCTTCCATTC Chr15:102018692..102018711 59.36 50
downstream ENSMUSE00000133114 Chr15:102018438..102018528 GTGTTGAGGCTCTCCGTGAT Chr15:102018422..102018441 60.27 55
downstream ENSMUSE00000133123 Chr15:102017997..102018103 CTTCCATGAGCACAAACACG Chr15:102018041..102018060 60.3 50
downstream ENSMUSE00000133117 Chr15:102017485..102017600 GGTTCATGGCGTACATGTTG Chr15:102017546..102017565 59.85 50
downstream ENSMUSE00000133118 Chr15:102016825..102016904 TCCCTTGGTGATGGAGTAGTG Chr15:102016859..102016879 59.97 52.38
downstream ENSMUSE00000133126 Chr15:102016429..102016483 GCCAGAATGATCTGCCTCTC Chr15:102016417..102016436 59.92 55
downstream ENSMUSE00000549222 Chr15:102010402..102010518 GTGGTACCAGAGGTGGCACT Chr15:102010456..102010475 60.03 60
downstream ENSMUSE00000133125 Chr15:102010260..102010324 CATCCAGGAGATGCCTGTGT Chr15:102010248..102010267 61.1 55
downstream ENSMUSE00000133113 Chr15:102009952..102010033 AGAAGAAGAGCGGAGCACTG Chr15:102009943..102009962 59.89 55
downstream ENSMUSE00000133112 Chr15:102009392..102009591 TGTCCAGAGCCACATCGTAG Chr15:102009491..102009510 59.85 55
downstream ENSMUSE00000133122 Chr15:102009212..102009263 ACTCAAATCCTTCCCGCTTT Chr15:102009201..102009220 60.07 45
downstream ENSMUSE00000133121 Chr15:102008958..102009047 AGAAGCACACGTTGACGAACT Chr15:102009001..102009021 59.97 47.62
downstream ENSMUSE00000133124 Chr15:102007429..102008217 CACCACCATTCGGAAGAAGT Chr15:102008097..102008116 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCAGCTCGTCTGATCCTT Chr15:102019340..102019360 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCAGCTCGTCTGATCCTT Chr15:102019340..102019360 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023044