Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16910
Trapped Gene
Abca3 (ENSMUSG00000024130)
Vector Insertion
Chr 17: 24489197 - 24494863
Public Clones not available
Private Clones OST452397 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465751 (Chr17:24488991..24489196 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGGACCGGGAGTCTAAG Chr17:24489120..24489139 60.78 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465751 (Chr17:24488991..24489196 +)
Downstram Exon
ENSMUSE00000508352 (Chr17:24494864..24494936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGGACCGGGAGTCTAAG Chr17:24489120..24489139 60.78 60 CAGTGGAGGGATAGTGAGCAA Chr17:24494900..24494920 60.26 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000465751 Chr17:24488991..24489196 AGCAGGACCGGGAGTCTAAG Chr17:24489120..24489139 60.78 60

*** Putative Vector Insertion (Chr 17: 24489197 - 24494863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508352 Chr17:24494864..24494936 CAGTGGAGGGATAGTGAGCAA Chr17:24494900..24494920 60.26 52.38
downstream ENSMUSE00000502528 Chr17:24497833..24498034 TGGCGTCAGCAGTTCTACAC Chr17:24497979..24497998 60.06 55
downstream ENSMUSE00000504732 Chr17:24501422..24501531 TCCAGAGTAGGAGGGTGAGC Chr17:24501517..24501536 59.4 60
downstream ENSMUSE00000710645 Chr17:24501427..24501531 TCCAGAGTAGGAGGGTGAGC Chr17:24501517..24501536 59.4 60
downstream ENSMUSE00000308320 Chr17:24501638..24501902 CTCCGACTGGATCTTCAAGC Chr17:24501733..24501752 59.95 55
downstream ENSMUSE00000308291 Chr17:24503031..24503158 TGGTTGAAGCTGTGCTCAAA Chr17:24503136..24503155 60.57 45
downstream ENSMUSE00000353744 Chr17:24503713..24503878 AACTGAAGCGCAGGTGGTAT Chr17:24503740..24503759 59.76 50
downstream ENSMUSE00000367899 Chr17:24511189..24511448 GGTGAGGGAGGTGTAGGTGA Chr17:24511409..24511428 59.96 60
downstream ENSMUSE00000400483 Chr17:24513309..24513425 CAGCTGTTAAGCCCCATCAT Chr17:24513343..24513362 60.1 50
downstream ENSMUSE00000355396 Chr17:24513610..24513730 GGAGATTGCAAAACACAGCA Chr17:24513690..24513709 59.85 45
downstream ENSMUSE00000308121 Chr17:24514631..24514804 CGAGGAGCCACGAAAAAGTA Chr17:24514706..24514725 60.38 50
downstream ENSMUSE00000138583 Chr17:24518844..24519025 GAAGACAGCCTCCACGTACC Chr17:24518983..24519002 59.73 60
downstream ENSMUSE00000138581 Chr17:24520845..24520988 GCTCGGCTTCAAAGTACTCG Chr17:24520947..24520966 60.15 55
downstream ENSMUSE00000308073 Chr17:24521392..24521521 AGACATGGTCGTGGTCTTCC Chr17:24521514..24521533 59.97 55
downstream ENSMUSE00000332778 Chr17:24522343..24522497 GGGAAATTTCGTACCCATGA Chr17:24522399..24522418 59.62 45
downstream ENSMUSE00000473289 Chr17:24522762..24522917 GGACCGTAAGTCACGCTTGT Chr17:24522854..24522873 60.18 55
downstream ENSMUSE00000472644 Chr17:24523127..24523337 CAGCTTCGTCCATGAAGTGA Chr17:24523256..24523275 59.98 50
downstream ENSMUSE00000307956 Chr17:24524381..24524531 TACCAGCGTCATGTGGTAGC Chr17:24524409..24524428 59.75 55
downstream ENSMUSE00000371881 Chr17:24529833..24529931 ACTTCCTCCATGGTGGTGAC Chr17:24529925..24529944 59.82 55
downstream ENSMUSE00000405572 Chr17:24533395..24533581 CTCTATGAGGGCTCCAATGC Chr17:24533551..24533570 59.8 55
downstream ENSMUSE00000375719 Chr17:24534231..24534534 AGAAGGGCACAACCGTTCTA Chr17:24534444..24534463 59.73 50
downstream ENSMUSE00000346850 Chr17:24535280..24535553 TGGTATGCCTGGTTGTTGAA Chr17:24535421..24535440 59.96 45
downstream ENSMUSE00000307772 Chr17:24536830..24537034 GACACCGCTCACAAACTGAA Chr17:24536962..24536981 59.88 50
downstream ENSMUSE00000307743 Chr17:24537353..24537572 GGTACATGAGGGGGATGATG Chr17:24537464..24537483 60.01 55
downstream ENSMUSE00000307712 Chr17:24537739..24537897 GCAGTATCGCCGAGTCTCAT Chr17:24537860..24537879 60.39 55
downstream ENSMUSE00000410080 Chr17:24539210..24539382 TCCAGGCATAGAAGCTCTCC Chr17:24539245..24539264 59.53 55
downstream ENSMUSE00000374412 Chr17:24541970..24542098 ATGTCCGGTTCTGCAGTTCT Chr17:24541994..24542013 59.73 50
downstream ENSMUSE00000307660 Chr17:24542190..24542384 TCCCGATGTCAGAACTGATG Chr17:24542385..24542404 59.63 50
downstream ENSMUSE00000307635 Chr17:24544503..24544690 GAGCCGTGCATACATAACCA Chr17:24544595..24544614 59.57 50
downstream ENSMUSE00000611931 Chr17:24545054..24545224 CAGTGCTTAGCTTGCGTTTG Chr17:24545085..24545104 59.81 50
downstream ENSMUSE00000499156 Chr17:24545482..24545672 CTTGCTCTTGAGGTGCTGTG Chr17:24545578..24545597 59.77 55
downstream ENSMUSE00000138588 Chr17:24545770..24545843 AGCCAGGCAGATGATAATGG Chr17:24545826..24545845 60.06 50
downstream ENSMUSE00000552910 Chr17:24546214..24547146 AGTGGTCCCTGACAATCCTG Chr17:24547067..24547086 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:24492247..24492267 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGAGACGTGACTGGGAAA Chr17:24489241..24489261 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024130