Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16919
Trapped Gene
Tln1 (ENSMUSG00000028465)
Vector Insertion
Chr 4: 43569492 - 43569656
Public Clones not available
Private Clones OST452305 (lexicon) OST448298 (lexicon) OST406600 (lexicon) OST314818 (lexicon)
OST281341 (lexicon) OST222812 (lexicon) OST178619 (lexicon) OST37794 (lexicon)
OST33128 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711522 (Chr4:43569493..43569655 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711522 (Chr4:43569493..43569655 -)
Downstram Exon
ENSMUSE00000716731 (Chr4:43569493..43569655 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45 GGCTCAAATTGCATCGTCTT Chr4:43569539..43569558 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289986 Chr4:43575002..43575127 GAAGTGGCCGAGAGTGTGTC Chr4:43575091..43575110 60.87 60
upstream ENSMUSE00000711522 Chr4:43569493..43569655 ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45
upstream ENSMUSE00000716731 Chr4:43569493..43569655 ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45

*** Putative Vector Insertion (Chr 4: 43569492 - 43569656) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000179477 Chr4:43569161..43569258 CCCATTTCGGAGCATGTAGT Chr4:43569139..43569158 59.96 50
downstream ENSMUSE00000674764 Chr4:43569161..43569258 CCCATTTCGGAGCATGTAGT Chr4:43569139..43569158 59.96 50
downstream ENSMUSE00000179473 Chr4:43568727..43568856 CTGTGACGGTCTTGGAGTCA Chr4:43568735..43568754 59.86 55
downstream ENSMUSE00000674763 Chr4:43568727..43568856 CTGTGACGGTCTTGGAGTCA Chr4:43568735..43568754 59.86 55
downstream ENSMUSE00000179429 Chr4:43568474..43568626 CTTCCATCAGCTCTCGAACC Chr4:43568557..43568576 59.95 55
downstream ENSMUSE00000674762 Chr4:43568474..43568626 CTTCCATCAGCTCTCGAACC Chr4:43568557..43568576 59.95 55
downstream ENSMUSE00000179459 Chr4:43568141..43568283 AAGAACTTTCTCCGCAGCAG Chr4:43568180..43568199 59.76 50
downstream ENSMUSE00000674761 Chr4:43568141..43568283 AAGAACTTTCTCCGCAGCAG Chr4:43568180..43568199 59.76 50
downstream ENSMUSE00000179446 Chr4:43567919..43568046 ACAGGCCTTGTCAAAGGAGA Chr4:43567971..43567990 59.84 50
downstream ENSMUSE00000674760 Chr4:43567919..43568046 ACAGGCCTTGTCAAAGGAGA Chr4:43567971..43567990 59.84 50
downstream ENSMUSE00000179474 Chr4:43567150..43567210 TCTTACGCTCTCCCTTCTGC Chr4:43567136..43567155 59.72 55
downstream ENSMUSE00000674759 Chr4:43567150..43567210 TCTTACGCTCTCCCTTCTGC Chr4:43567136..43567155 59.72 55
downstream ENSMUSE00000527570 Chr4:43566318..43566422 TAGCGTACCTTGGCCTCAAT Chr4:43566351..43566370 59.73 50
downstream ENSMUSE00000674758 Chr4:43566318..43566422 TAGCGTACCTTGGCCTCAAT Chr4:43566351..43566370 59.73 50
downstream ENSMUSE00000527569 Chr4:43565858..43566013 ATCCACACGCATCACACACT Chr4:43565917..43565936 60.04 50
downstream ENSMUSE00000674757 Chr4:43565858..43566013 ATCCACACGCATCACACACT Chr4:43565917..43565936 60.04 50
downstream ENSMUSE00000179439 Chr4:43564058..43564159 CTCGCCTTCTGTCGTCTGTA Chr4:43564084..43564103 59.19 55
downstream ENSMUSE00000179441 Chr4:43563834..43563910 GGGTGACACTGAGTCCTCCA Chr4:43563817..43563836 61.15 60
downstream ENSMUSE00000179442 Chr4:43563070..43563250 TTTCCCCACTCGGTTGTACT Chr4:43563189..43563208 59.45 50
downstream ENSMUSE00000179490 Chr4:43562810..43562923 CTGCATGCTGGAGTTAATGG Chr4:43562854..43562873 59.3 50
downstream ENSMUSE00000179436 Chr4:43562595..43562703 GGGAGTGGATCTCATGCTTT Chr4:43562624..43562643 59.09 50
downstream ENSMUSE00000179470 Chr4:43562193..43562401 ATCTCCGTCAGGTTGGAAGA Chr4:43562307..43562326 59.65 50
downstream ENSMUSE00000179455 Chr4:43561958..43562056 GTGGGGGTCAGTGTCACTTT Chr4:43561942..43561961 59.86 55
downstream ENSMUSE00000674756 Chr4:43560995..43561018 No primer for this exon
downstream ENSMUSE00000179453 Chr4:43560851..43561018 TAGCTGCAGCAATCACTTGG Chr4:43560873..43560892 60.16 50
downstream ENSMUSE00000179466 Chr4:43560374..43560668 TGGTATCAGTGGCTTGGTCA Chr4:43560397..43560416 60.11 50
downstream ENSMUSE00000674755 Chr4:43560374..43560473 TGGTATCAGTGGCTTGGTCA Chr4:43560397..43560416 60.11 50
downstream ENSMUSE00000674773 Chr4:43560374..43560518 TGGTATCAGTGGCTTGGTCA Chr4:43560397..43560416 60.11 50
downstream ENSMUSE00000674772 Chr4:43559724..43559788 AGCATTGACCAGGTCTGAGG Chr4:43559708..43559727 60.26 55
downstream ENSMUSE00000718914 Chr4:43559622..43559788 GCATTGACCAGGTCTGAGGT Chr4:43559709..43559728 60.12 55
downstream ENSMUSE00000721103 Chr4:43559622..43559788 GCATTGACCAGGTCTGAGGT Chr4:43559709..43559728 60.12 55
downstream ENSMUSE00000179448 Chr4:43558732..43558860 CGCTGCACCAACTTCTTCTT Chr4:43558717..43558736 60.57 50
downstream ENSMUSE00000674753 Chr4:43558732..43558860 CGCTGCACCAACTTCTTCTT Chr4:43558717..43558736 60.57 50
downstream ENSMUSE00000179444 Chr4:43558478..43558594 CTGCAGCAATGGTCTGTGTT Chr4:43558524..43558543 59.9 50
downstream ENSMUSE00000674752 Chr4:43558478..43558594 CTGCAGCAATGGTCTGTGTT Chr4:43558524..43558543 59.9 50
downstream ENSMUSE00000674771 Chr4:43558478..43558519 TACAGCTCTGCACCAGTAGGG Chr4:43558458..43558478 60.46 57.14
downstream ENSMUSE00000660844 Chr4:43558279..43558392 GAGCTTGACTTCCTCGGACA Chr4:43558316..43558335 60.53 55
downstream ENSMUSE00000710922 Chr4:43558279..43558392 GAGCTTGACTTCCTCGGACA Chr4:43558316..43558335 60.53 55
downstream ENSMUSE00000720893 Chr4:43558279..43558392 GAGCTTGACTTCCTCGGACA Chr4:43558316..43558335 60.53 55
downstream ENSMUSE00000179464 Chr4:43557966..43558100 GGTCCTGAATTGTTGGCACT Chr4:43558024..43558043 59.97 50
downstream ENSMUSE00000674769 Chr4:43557966..43558100 GGTCCTGAATTGTTGGCACT Chr4:43558024..43558043 59.97 50
downstream ENSMUSE00000179438 Chr4:43557713..43557841 CCATCTCCAAAGGTCCACAT Chr4:43557789..43557808 59.78 50
downstream ENSMUSE00000674767 Chr4:43557713..43557841 CCATCTCCAAAGGTCCACAT Chr4:43557789..43557808 59.78 50
downstream ENSMUSE00000179472 Chr4:43557448..43557550 TTTGGTGCTGTTGCCAAGAT Chr4:43557490..43557509 61.61 45
downstream ENSMUSE00000674766 Chr4:43557448..43557550 TTTGGTGCTGTTGCCAAGAT Chr4:43557490..43557509 61.61 45
downstream ENSMUSE00000674765 Chr4:43557175..43557360 CTGGCTGTGTCAAGCACAAT Chr4:43557224..43557243 59.9 50
downstream ENSMUSE00000179430 Chr4:43557152..43557360 CTGGCTGTGTCAAGCACAAT Chr4:43557224..43557243 59.9 50
downstream ENSMUSE00000674750 Chr4:43557152..43557360 CTGGCTGTGTCAAGCACAAT Chr4:43557224..43557243 59.9 50
downstream ENSMUSE00000179481 Chr4:43556689..43556808 CGTAGGGCATTATCCACGTC Chr4:43556707..43556726 60.35 55
downstream ENSMUSE00000674749 Chr4:43556689..43556808 CGTAGGGCATTATCCACGTC Chr4:43556707..43556726 60.35 55
downstream ENSMUSE00000179451 Chr4:43556308..43556505 TTCATTCAATCGGCTCTGTG Chr4:43556433..43556452 59.8 45
downstream ENSMUSE00000674748 Chr4:43556308..43556505 TTCATTCAATCGGCTCTGTG Chr4:43556433..43556452 59.8 45
downstream ENSMUSE00000179433 Chr4:43556016..43556155 GATATGCCCTTCAGGTTGGA Chr4:43556087..43556106 59.89 50
downstream ENSMUSE00000674747 Chr4:43556016..43556155 GATATGCCCTTCAGGTTGGA Chr4:43556087..43556106 59.89 50
downstream ENSMUSE00000179463 Chr4:43555747..43555840 GTTGATGCTGTCCGTCACTG Chr4:43555797..43555816 60.32 55
downstream ENSMUSE00000674746 Chr4:43555747..43555840 GTTGATGCTGTCCGTCACTG Chr4:43555797..43555816 60.32 55
downstream ENSMUSE00000179435 Chr4:43555574..43555663 TCCAGGAGTTCTCGGACTGT Chr4:43555622..43555641 59.83 55
downstream ENSMUSE00000674744 Chr4:43555574..43555663 TCCAGGAGTTCTCGGACTGT Chr4:43555622..43555641 59.83 55
downstream ENSMUSE00000179479 Chr4:43555353..43555475 CAATGGCATCTCCAAACTCC Chr4:43555378..43555397 60.46 50
downstream ENSMUSE00000674743 Chr4:43555353..43555475 CAATGGCATCTCCAAACTCC Chr4:43555378..43555397 60.46 50
downstream ENSMUSE00000179488 Chr4:43553402..43553545 GTTCCACCAGTCCTTGCTGT Chr4:43553460..43553479 60.16 55
downstream ENSMUSE00000674742 Chr4:43553402..43553545 GTTCCACCAGTCCTTGCTGT Chr4:43553460..43553479 60.16 55
downstream ENSMUSE00000179469 Chr4:43552848..43553009 AGGCGACAGCTGTTACACAA Chr4:43552926..43552945 59.51 50
downstream ENSMUSE00000674740 Chr4:43552848..43553009 AGGCGACAGCTGTTACACAA Chr4:43552926..43552945 59.51 50
downstream ENSMUSE00000179485 Chr4:43552509..43552649 CTGGAGAACTCAGGGTTGGA Chr4:43552512..43552531 60.23 55
downstream ENSMUSE00000674739 Chr4:43552509..43552649 CTGGAGAACTCAGGGTTGGA Chr4:43552512..43552531 60.23 55
downstream ENSMUSE00000179482 Chr4:43552238..43552419 GTCTCGGGGATTGACTGCTA Chr4:43552293..43552312 60.22 55
downstream ENSMUSE00000674738 Chr4:43552238..43552419 GTCTCGGGGATTGACTGCTA Chr4:43552293..43552312 60.22 55
downstream ENSMUSE00000179487 Chr4:43551963..43552095 AATGGCTGTCTCACACTCCA Chr4:43552034..43552053 59.26 50
downstream ENSMUSE00000674737 Chr4:43551963..43552095 AATGGCTGTCTCACACTCCA Chr4:43552034..43552053 59.26 50
downstream ENSMUSE00000179458 Chr4:43551550..43551651 CGGCTCAATGAGATGAGAAA Chr4:43551573..43551592 58.95 45
downstream ENSMUSE00000674735 Chr4:43551550..43551651 CGGCTCAATGAGATGAGAAA Chr4:43551573..43551592 58.95 45
downstream ENSMUSE00000179484 Chr4:43551304..43551474 CCAGGGTGAGTGGTTCAAAG Chr4:43551413..43551432 60.54 55
downstream ENSMUSE00000674733 Chr4:43551304..43551474 CCAGGGTGAGTGGTTCAAAG Chr4:43551413..43551432 60.54 55
downstream ENSMUSE00000179462 Chr4:43551062..43551211 CAGGTCTTCTACGGCCTCTG Chr4:43551121..43551140 60.01 60
downstream ENSMUSE00000674732 Chr4:43551062..43551211 CAGGTCTTCTACGGCCTCTG Chr4:43551121..43551140 60.01 60
downstream ENSMUSE00000179461 Chr4:43550858..43550959 GGGTCACCCATAGGTCCTTC Chr4:43550912..43550931 60.58 60
downstream ENSMUSE00000674731 Chr4:43550858..43550959 GGGTCACCCATAGGTCCTTC Chr4:43550912..43550931 60.58 60
downstream ENSMUSE00000179471 Chr4:43550660..43550779 AGAGGGCCTAGCTCTTCAGG Chr4:43550717..43550736 60.11 60
downstream ENSMUSE00000674730 Chr4:43550660..43550779 AGAGGGCCTAGCTCTTCAGG Chr4:43550717..43550736 60.11 60
downstream ENSMUSE00000179447 Chr4:43549396..43549542 GTGTTTGATGTGAGCGCCTA Chr4:43549500..43549519 59.87 50
downstream ENSMUSE00000674728 Chr4:43549396..43549542 GTGTTTGATGTGAGCGCCTA Chr4:43549500..43549519 59.87 50
downstream ENSMUSE00000179475 Chr4:43549116..43549282 CAGCACCCTCACGGTTAAGT Chr4:43549113..43549132 60.17 55
downstream ENSMUSE00000674727 Chr4:43549116..43549282 CAGCACCCTCACGGTTAAGT Chr4:43549113..43549132 60.17 55
downstream ENSMUSE00000289719 Chr4:43548825..43549008 CAGCTGCATTCTGCACTAGG Chr4:43548919..43548938 59.76 55
downstream ENSMUSE00000674726 Chr4:43548825..43549008 CAGCTGCATTCTGCACTAGG Chr4:43548919..43548938 59.76 55
downstream ENSMUSE00000289709 Chr4:43548610..43548735 ACTGCATTGATCAGCACCAC Chr4:43548694..43548713 59.71 50
downstream ENSMUSE00000674725 Chr4:43548610..43548735 ACTGCATTGATCAGCACCAC Chr4:43548694..43548713 59.71 50
downstream ENSMUSE00000354369 Chr4:43548392..43548508 CGTATGTGCTCTGTGGTTGC Chr4:43548383..43548402 60.33 55
downstream ENSMUSE00000674724 Chr4:43548392..43548508 CGTATGTGCTCTGTGGTTGC Chr4:43548383..43548402 60.33 55
downstream ENSMUSE00000413328 Chr4:43547452..43547637 TTCAGGGGTAGAGGTCTTGG Chr4:43547571..43547590 59.13 55
downstream ENSMUSE00000674723 Chr4:43547452..43547637 TTCAGGGGTAGAGGTCTTGG Chr4:43547571..43547590 59.13 55
downstream ENSMUSE00000372500 Chr4:43547262..43547369 GTACATCAGGCGCCACTTCT Chr4:43547311..43547330 60.28 55
downstream ENSMUSE00000674722 Chr4:43547262..43547369 GTACATCAGGCGCCACTTCT Chr4:43547311..43547330 60.28 55
downstream ENSMUSE00000403999 Chr4:43546735..43546840 TCCAGTTAGCTGCTGCTTCA Chr4:43546774..43546793 59.89 50
downstream ENSMUSE00000674721 Chr4:43546735..43546840 TCCAGTTAGCTGCTGCTTCA Chr4:43546774..43546793 59.89 50
downstream ENSMUSE00000179486 Chr4:43546426..43546550 TTCAGCTGCTCCAGCTTCTT Chr4:43546423..43546442 60.42 50
downstream ENSMUSE00000674719 Chr4:43546426..43546550 TTCAGCTGCTCCAGCTTCTT Chr4:43546423..43546442 60.42 50
downstream ENSMUSE00000179457 Chr4:43546176..43546301 CTGACGCAGCCTTTACCAGT Chr4:43546186..43546205 60.45 55
downstream ENSMUSE00000674718 Chr4:43546176..43546301 CTGACGCAGCCTTTACCAGT Chr4:43546186..43546205 60.45 55
downstream ENSMUSE00000179460 Chr4:43545998..43546060 ACCACTGCCCATCATCCAGT Chr4:43545996..43546015 62.76 55
downstream ENSMUSE00000674717 Chr4:43545998..43546060 ACCACTGCCCATCATCCAGT Chr4:43545996..43546015 62.76 55
downstream ENSMUSE00000179428 Chr4:43545702..43545884 CTGCGTTAGCTGCTTCACAC Chr4:43545811..43545830 59.81 55
downstream ENSMUSE00000674716 Chr4:43545702..43545884 CTGCGTTAGCTGCTTCACAC Chr4:43545811..43545830 59.81 55
downstream ENSMUSE00000179450 Chr4:43545064..43545192 CACCACCGTCTCATTCTCCT Chr4:43545075..43545094 60.11 55
downstream ENSMUSE00000674715 Chr4:43545064..43545192 CACCACCGTCTCATTCTCCT Chr4:43545075..43545094 60.11 55
downstream ENSMUSE00000347950 Chr4:43544393..43544957 TGGGTTTACAACCCTCAAGC Chr4:43544401..43544420 59.97 50
downstream ENSMUSE00000660843 Chr4:43544393..43544957 TGGGTTTACAACCCTCAAGC Chr4:43544401..43544420 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTTCGGTGAGGGTGTAT Chr4:43569680..43569700 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTTCGGTGAGGGTGTAT Chr4:43569680..43569700 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028465