Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16926
Trapped Gene
Gss (ENSMUSG00000027610)
Vector Insertion
Chr 2: 155413313 - 155418429
Public Clones (ggtc) (ggtc)
Private Clones OST452213 (lexicon) OST405043 (lexicon) OST379735 (lexicon) OST376904 (lexicon)
OST344989 (lexicon) OST317771 (lexicon) OST304479 (lexicon) OST287751 (lexicon)
OST265347 (lexicon) OST232511 (lexicon) OST212148 (lexicon) OST145192 (lexicon)
OST125908 (lexicon) OST57751 (lexicon) OST25690 (lexicon) OST13444 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639694 (Chr2:155418430..155418466 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639694 (Chr2:155418430..155418466 -)
Downstram Exon
ENSMUSE00000324830 (Chr2:155413178..155413312 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCAGTTCTTCGAGCTGCTTC Chr2:155413230..155413249 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639694 Chr2:155418430..155418466 No primer for this exon

*** Putative Vector Insertion (Chr 2: 155413313 - 155418429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000324830 Chr2:155413178..155413312 CCAGTTCTTCGAGCTGCTTC Chr2:155413230..155413249 60.28 55
downstream ENSMUSE00000171100 Chr2:155407624..155407769 TTGAAGTCCATCTGCACAGC Chr2:155407659..155407678 59.99 50
downstream ENSMUSE00000171099 Chr2:155404448..155404523 CGGGCAGTATAGTCGTCCTT Chr2:155404472..155404491 59.22 55
downstream ENSMUSE00000171085 Chr2:155404025..155404164 TCGATCTGTTTCAGGGCTTT Chr2:155404063..155404082 59.81 45
downstream ENSMUSE00000171081 Chr2:155403258..155403374 AGTCCCTTGCTGGGGTTATT Chr2:155403281..155403300 59.83 50
downstream ENSMUSE00000171087 Chr2:155398831..155398911 GCACGCTGGTCAAATATGTTC Chr2:155398833..155398853 60.53 47.62
downstream ENSMUSE00000171080 Chr2:155398660..155398737 CTTCGGTTTTGGTCCAGAGA Chr2:155398647..155398666 60.22 50
downstream ENSMUSE00000171092 Chr2:155397255..155397321 CTCGGAAGTACACCACAGCA Chr2:155397265..155397284 59.9 55
downstream ENSMUSE00000171097 Chr2:155393429..155393623 GCTGTATGGCAATGTCTGGA Chr2:155393535..155393554 59.68 50
downstream ENSMUSE00000171095 Chr2:155392539..155392620 AAGTGGCTAGGAGCAGCAAG Chr2:155392546..155392565 59.78 55
downstream ENSMUSE00000171089 Chr2:155390496..155390685 TGTACCATTTCCTCCCCGTA Chr2:155390633..155390652 60.18 50
downstream ENSMUSE00000368457 Chr2:155388923..155389455 AGGCACTAGAACCTGCTGGA Chr2:155388988..155389007 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTGTCAAAGCGTTGTGC Chr2:155418424..155418444 60.03 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACAACGAGCGAGTAAG Chr2:155418423..155418443 58.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCGAGTAAGTCGGGGCTAAT Chr2:155418412..155418432 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTCAAAGCGTTGTGCTGAG Chr2:155418420..155418440 61.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027610