Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16936
Trapped Gene
Cisd2 (ENSMUSG00000028165)
Vector Insertion
Chr 3: 135073974 - 135074190
Public Clones not available
Private Clones OST452154 (lexicon) OST432333 (lexicon) OST422789 (lexicon) OST358849 (lexicon)
OST355716 (lexicon) OST329819 (lexicon) OST238473 (lexicon) OST204385 (lexicon)
OST74580 (lexicon) OST68121 (lexicon) OST64091 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176946 (Chr3:135073975..135074189 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAAGGTGGTGAATGAGAT Chr3:135074036..135074055 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176946 (Chr3:135073975..135074189 -)
Downstram Exon
ENSMUSE00000713419 (Chr3:135072976..135074189 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAAGGTGGTGAATGAGAT Chr3:135074036..135074055 59.78 50 CTACAGGCACGATCAAGCAA Chr3:135073742..135073761 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410038 Chr3:135086223..135086889 CCACAAGACAAGCGTGGTTA Chr3:135086785..135086804 59.76 50
upstream ENSMUSE00000714064 Chr3:135086223..135086371 No primer for this exon
upstream ENSMUSE00000176946 Chr3:135073975..135074189 CCCAAGGTGGTGAATGAGAT Chr3:135074036..135074055 59.78 50

*** Putative Vector Insertion (Chr 3: 135073974 - 135074190) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713419 Chr3:135072976..135074189 CTACAGGCACGATCAAGCAA Chr3:135073742..135073761 60.01 50
downstream ENSMUSE00000341386 Chr3:135069378..135071854 CAGGCAGACAGGCACTCATA Chr3:135069902..135069921 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTTCCAGGAGAGTCGTG Chr3:135074214..135074234 60.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTTCCAGGAGAGTCGTG Chr3:135074214..135074234 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028165