Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16938
Trapped Gene
Atp8a1 (ENSMUSG00000037685)
Vector Insertion
Chr 5: 68205963 - 68238400
Public Clones not available
Private Clones OST452140 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711983 (Chr5:68238401..68238670 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711983 (Chr5:68238401..68238670 -)
Downstram Exon
ENSMUSE00000498333 (Chr5:68205848..68205962 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCTGGTTGATGAAGATGGT Chr5:68205859..68205878 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696638 Chr5:68238401..68238670 No primer for this exon
upstream ENSMUSE00000711983 Chr5:68238401..68238670 No primer for this exon

*** Putative Vector Insertion (Chr 5: 68205963 - 68238400) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498333 Chr5:68205848..68205962 GGCTGGTTGATGAAGATGGT Chr5:68205859..68205878 59.93 50
downstream ENSMUSE00000497271 Chr5:68204331..68204430 ATTAGCCGCTCTTCGGAACT Chr5:68204339..68204358 60.36 50
downstream ENSMUSE00000467174 Chr5:68203327..68203425 No primer for this exon
downstream ENSMUSE00000466269 Chr5:68196896..68196941 GCATTATCAGCCTTGTGTCG Chr5:68196897..68196916 59.3 50
downstream ENSMUSE00000465404 Chr5:68177865..68177905 CCATGCACCATTTCTCAAAA Chr5:68177864..68177883 59.52 40
downstream ENSMUSE00000696562 Chr5:68177865..68177905 CCATGCACCATTTCTCAAAA Chr5:68177864..68177883 59.52 40
downstream ENSMUSE00000485951 Chr5:68172227..68172300 CGAGAGAAGGACAGTGTCAGC Chr5:68172210..68172230 60.19 57.14
downstream ENSMUSE00000696561 Chr5:68172118..68172300 CAAGGTCAATGCAGGGTAGAG Chr5:68172141..68172161 59.74 52.38
downstream ENSMUSE00000696565 Chr5:68172118..68172300 CAAGGTCAATGCAGGGTAGAG Chr5:68172141..68172161 59.74 52.38
downstream ENSMUSE00000464523 Chr5:68170199..68170272 GTTCCCCATTGGTCACCTTC Chr5:68170211..68170230 61.53 55
downstream ENSMUSE00000463128 Chr5:68167368..68167437 No primer for this exon
downstream ENSMUSE00000462204 Chr5:68165962..68166089 TGTCGGTTTGGACTTTCACA Chr5:68165982..68166001 60.13 45
downstream ENSMUSE00000472561 Chr5:68160291..68160402 TCGGAGAAGGATCTGGTCTG Chr5:68160344..68160363 60.34 55
downstream ENSMUSE00000468433 Chr5:68158259..68158424 CCGTTCCACATTGGAGAGTT Chr5:68158361..68158380 59.97 50
downstream ENSMUSE00000251307 Chr5:68156103..68156230 GCTGATGGGAATGAGGTTGT Chr5:68156135..68156154 59.93 50
downstream ENSMUSE00000251303 Chr5:68153755..68153832 GGGCTCATAATGCATGTCAA Chr5:68153787..68153806 59.5 45
downstream ENSMUSE00000493365 Chr5:68152353..68152441 CAGGGTCCCAGTTTTGTCAG Chr5:68152384..68152403 60.54 55
downstream ENSMUSE00000515627 Chr5:68147889..68147933 AATCCTCAGGTTCAGGGACA Chr5:68147889..68147908 59.51 50
downstream ENSMUSE00000516274 Chr5:68142252..68142324 CAACGACGGGTCATTAAAGG Chr5:68142254..68142273 60.36 50
downstream ENSMUSE00000511007 Chr5:68140290..68140395 CTCTCCGGTACAGCTGTGTG Chr5:68140306..68140325 59.49 60
downstream ENSMUSE00000470133 Chr5:68138517..68138599 No primer for this exon
downstream ENSMUSE00000251273 Chr5:68136819..68136868 No primer for this exon
downstream ENSMUSE00000479817 Chr5:68129652..68129721 GTAACTTCCCGGATGGAGTG Chr5:68129650..68129669 59.4 55
downstream ENSMUSE00000251262 Chr5:68123408..68123492 TTGAGGTCTCTGCAAGTCGTT Chr5:68123434..68123454 60.04 47.62
downstream ENSMUSE00000475681 Chr5:68121031..68121170 CTGTTCTGTACCGACGTGGA Chr5:68121049..68121068 59.74 55
downstream ENSMUSE00000514492 Chr5:68097145..68097283 TTGCTTGTCCCCAGTAAGGA Chr5:68097142..68097161 60.63 50
downstream ENSMUSE00000516489 Chr5:68094219..68094283 GAGAGCCCTCGTTTATCACG Chr5:68094202..68094221 59.84 55
downstream ENSMUSE00000466372 Chr5:68073997..68074169 ACGCCAAAGGTTAAGGCATA Chr5:68074029..68074048 59.61 45
downstream ENSMUSE00000251238 Chr5:68058763..68058946 CATCTCGACAACCTCGGACT Chr5:68058888..68058907 60.26 55
downstream ENSMUSE00000251231 Chr5:68058560..68058670 CACCGTGAACCATCAACAAA Chr5:68058612..68058631 60.4 45
downstream ENSMUSE00000251226 Chr5:68051333..68051407 No primer for this exon
downstream ENSMUSE00000463304 Chr5:68051109..68051231 TCCAGAGCATTCTGGGATGT Chr5:68051100..68051119 60.62 50
downstream ENSMUSE00000251215 Chr5:68047145..68047223 GCTTTCAGTGGGAACCAAAA Chr5:68047134..68047153 60.09 45
downstream ENSMUSE00000251210 Chr5:68042827..68042888 CTGAGGTTTTCCCATTTCCA Chr5:68042837..68042856 59.9 45
downstream ENSMUSE00000251202 Chr5:68039764..68039820 CAGTCCAGCTTTCAAGCACA Chr5:68039763..68039782 60.17 50
downstream ENSMUSE00000251196 Chr5:68038932..68039039 GCAGGCCACAGAGATGAGTAG Chr5:68038941..68038961 60.03 57.14
downstream ENSMUSE00000251189 Chr5:68022726..68022814 GCACATCCAGAAGCAAGGAC Chr5:68022714..68022733 60.81 55
downstream ENSMUSE00000251179 Chr5:68021930..68022022 CTTGAGATTTCGCCTCAAGC Chr5:68021936..68021955 60.1 50
downstream ENSMUSE00000251171 Chr5:68015249..68015340 GACTCGGAGCGGTACAGATT Chr5:68015247..68015266 59.31 55
downstream ENSMUSE00000652965 Chr5:68009379..68013935 ATACGGGTAGTCGCCATGAG Chr5:68012717..68012736 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTCAGGTAATCGCCTTGC Chr5:68232337..68232357 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTTCGTGACTGGGAAA Chr5:68232336..68232356 60.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037685