Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16951
Trapped Gene
Rpl6 (ENSMUSG00000029614)
Vector Insertion
Chr 5: 121654562 - 121655414
Public Clones IST14288C8 (tigm)
Private Clones OST451957 (lexicon) OST425218 (lexicon) OST385238 (lexicon) OST334078 (lexicon)
OST271403 (lexicon) OST212503 (lexicon) OST185653 (lexicon) OST132075 (lexicon)
OST38848 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689179 (Chr5:121654543..121654561 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689179 (Chr5:121654543..121654561 +)
Downstram Exon
ENSMUSE00000465540 (Chr5:121655415..121655672 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTTTGTATCAGGCGCTTT Chr5:121655449..121655468 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689179 Chr5:121654543..121654561 No primer for this exon

*** Putative Vector Insertion (Chr 5: 121654562 - 121655414) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465540 Chr5:121655415..121655672 TCCTTTGTATCAGGCGCTTT Chr5:121655449..121655468 59.85 45
downstream ENSMUSE00000284199 Chr5:121655763..121655864 TTGTCCCCACCAACTGTTTT Chr5:121655830..121655849 60.25 45
downstream ENSMUSE00000284194 Chr5:121656676..121656819 CTGGAGCGTAGCCTTCTCAC Chr5:121656770..121656789 60.16 60
downstream ENSMUSE00000190743 Chr5:121657156..121657204 GTCCAGCTGCTTCAGGAAAA Chr5:121657185..121657204 60.52 50
downstream ENSMUSE00000190744 Chr5:121658400..121658584 GGGGATTTTAACATCGCTGA Chr5:121658500..121658519 59.9 45
downstream ENSMUSE00000617922 Chr5:121658791..121658976 AAACTGAGAGCGCAGGTAGC Chr5:121658904..121658923 59.79 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTCCCGTCTTGCAAGGTA Chr5:121654546..121654566 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCCCGTCTTGCAAGGTA Chr5:121654546..121654566 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029614