Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16958
Trapped Gene
Myd88 (ENSMUSG00000032508)
Vector Insertion
Chr 9: 119247829 - 119248749
Public Clones not available
Private Clones OST451846 (lexicon) OST232597 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000267747 (Chr9:119248750..119249138 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTGTTAGACCGTGAGGA Chr9:119248779..119248798 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000267747 (Chr9:119248750..119249138 -)
Downstram Exon
ENSMUSE00000267730 (Chr9:119247694..119247828 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTGTTAGACCGTGAGGA Chr9:119248779..119248798 60.26 55 TTCTCGGACTCCTGGTTCTG Chr9:119247755..119247774 60.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000267747 Chr9:119248750..119249138 GCCTTGTTAGACCGTGAGGA Chr9:119248779..119248798 60.26 55

*** Putative Vector Insertion (Chr 9: 119247829 - 119248749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267730 Chr9:119247694..119247828 TTCTCGGACTCCTGGTTCTG Chr9:119247755..119247774 60.38 55
downstream ENSMUSE00000220303 Chr9:119247124..119247304 GATATCGTTGGGGCAGTAGC Chr9:119247230..119247249 59.56 55
downstream ENSMUSE00000220300 Chr9:119246872..119246963 TGAGTGCAAACTTGGTCTGG Chr9:119246862..119246881 59.87 50
downstream ENSMUSE00000267677 Chr9:119246453..119246628 CAGTCGCTTCTGTTGGACAC Chr9:119246587..119246606 59.47 55
downstream ENSMUSE00000409270 Chr9:119245118..119246017 GGCAGTCCTAGTTGCTCAGG Chr9:119245874..119245893 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGCCTAATCGCCTTGCAG Chr9:119248684..119248704 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTGTGCCAAGGATCAAC Chr9:119248708..119248728 60.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032508