Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16965
Trapped Gene
2010316F05Rik (ENSMUSG00000032673)
Vector Insertion
Chr 11: 29413677 - 29414431
Public Clones CMHD-GT_389B8-3 (cmhd) CMHD-GT_365B12-3 (cmhd) CMHD-GT_395A11-3 (cmhd) CMHD-GT_479F9-3 (cmhd)
Private Clones OST451749 (lexicon) OST286398 (lexicon) OST210732 (lexicon) OST123812 (lexicon)
OST92776 (lexicon) OST27388 (lexicon) OST4421 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680444 (Chr11:29414432..29414522 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680444 (Chr11:29414432..29414522 -)
Downstram Exon
ENSMUSE00000371491 (Chr11:29412883..29413676 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCATCATCGCAGAAGAGTGA Chr11:29413392..29413411 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713169 Chr11:29414917..29415006 TGCGGGCTGAGTTAGAACAG Chr11:29414965..29414984 61.5 55
upstream ENSMUSE00000720315 Chr11:29414917..29415006 TGCGGGCTGAGTTAGAACAG Chr11:29414965..29414984 61.5 55
upstream ENSMUSE00000680444 Chr11:29414432..29414522 No primer for this exon

*** Putative Vector Insertion (Chr 11: 29413677 - 29414431) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000371491 Chr11:29412883..29413676 CCATCATCGCAGAAGAGTGA Chr11:29413392..29413411 59.94 50
downstream ENSMUSE00000680443 Chr11:29412883..29413676 CCATCATCGCAGAAGAGTGA Chr11:29413392..29413411 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGCCACAAACAAAAGTACG Chr11:29414425..29414446 59.68 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGCCACAAACAAAAGTACG Chr11:29414425..29414446 59.68 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032673