Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16977
Trapped Gene
Vangl1 (ENSMUSG00000027860)
Vector Insertion
Chr 3: 102000900 - 102008434
Public Clones 5SE306C03 (ggtc) IST13571A9 (tigm)
Private Clones OST451414 (lexicon) OST390162 (lexicon) OST280992 (lexicon) OST136808 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453892 (Chr3:102008435..102008531 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453892 (Chr3:102008435..102008531 -)
Downstram Exon
ENSMUSE00000453884 (Chr3:102000715..102000899 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AATGGCAAGCTTCGTCTGAT Chr3:102000767..102000786 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453892 Chr3:102008435..102008531 No primer for this exon

*** Putative Vector Insertion (Chr 3: 102000900 - 102008434) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453884 Chr3:102000715..102000899 AATGGCAAGCTTCGTCTGAT Chr3:102000767..102000786 59.84 45
downstream ENSMUSE00000453879 Chr3:101993332..101993470 GCCTGGATGGTGACAGACTT Chr3:101993371..101993390 60.12 55
downstream ENSMUSE00000453875 Chr3:101987874..101988481 AGACTGCGTATTGCACGATG Chr3:101987991..101988010 59.9 50
downstream ENSMUSE00000370676 Chr3:101970761..101970894 CTCGGAATTTGGATGCTGTT Chr3:101970781..101970800 60.07 45
downstream ENSMUSE00000173686 Chr3:101969278..101969410 TACAACTCGTTGTGGCTGGA Chr3:101969304..101969323 60.3 50
downstream ENSMUSE00000173682 Chr3:101967222..101967456 CATGCTGTGGTAGTGCTGCT Chr3:101967254..101967273 60.08 55
downstream ENSMUSE00000396395 Chr3:101962119..101962420 GAGCCATCGATCCTTGTCAT Chr3:101962336..101962355 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGACTCTAATCGCCTTGC Chr3:102002371..102002392 60.35 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACTCCGTGACTGGGAAA Chr3:102002370..102002390 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATGGCCAAAGGCTGTTAAG Chr3:102002508..102002528 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATGGCCAAAGGCTGTTAAG Chr3:102002508..102002528 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027860