Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16986
Trapped Gene
Fis1 (ENSMUSG00000019054)
Vector Insertion
Chr 5: 137439002 - 137440962
Public Clones not available
Private Clones OST451327 (lexicon) OST350452 (lexicon) OST262927 (lexicon) OST173224 (lexicon)
OST142631 (lexicon) OST127305 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000191921 (Chr5:137438869..137439001 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000191921 (Chr5:137438869..137439001 +)
Downstram Exon
ENSMUSE00000191920 (Chr5:137440963..137441039 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686657 Chr5:137429145..137429460 No primer for this exon
upstream ENSMUSE00000686659 Chr5:137429276..137429460 No primer for this exon
upstream ENSMUSE00000384594 Chr5:137437976..137438098 No primer for this exon
upstream ENSMUSE00000191921 Chr5:137438869..137439001 No primer for this exon

*** Putative Vector Insertion (Chr 5: 137439002 - 137440962) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000191920 Chr5:137440963..137441039 No primer for this exon
downstream ENSMUSE00000311399 Chr5:137441435..137441540 No primer for this exon
downstream ENSMUSE00000379515 Chr5:137441787..137442102 No primer for this exon
downstream ENSMUSE00000686658 Chr5:137441787..137442019 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAGCCTGACCTCTACTT Chr5:137439034..137439054 58.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCCTGACCTCTACTCGT Chr5:137439036..137439056 59.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019054